pGreenII- 62- SK


  • Model: PVT11188
  • 48 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT11188
Packing 2ug


pGreenII-62-SK Information

Function plant reporter plasmid

Promoter: CaMV 35S

Replicator: pSa ori, ori

Plasmid classification: plant series, protein overexpression vector

Plasmid size: 3347bp

Prokaryotic resistance: Kan

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: plant cells

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

3'sequencing primers: primers designed according to sequence


pGreenII-62-SK Description

pGreenII 62-SK-multiple-site



pGreenII-62-SK Sequence

LOCUS       Exported                3347 bp ds-DNA     circular SYN 14-SEP-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled 10

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 3347)


  TITLE     Direct Submission

  JOURNAL   Exported Wednesday, September 14, 2016 from SnapGene Viewer 3.2.1

FEATURES             Location/Qualifiers

     source          1..3347

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     misc_feature    542..564

                     /note="LB T-DNA repeat"

                     /note="left border repeat from nopaline C58 T-DNA 


     promoter        638..982

                     /note="CaMV 35S promoter"

                     /note="strong constitutive promoter from cauliflower mosaic


     misc_feature    992..1099


                     /note="pBluescript multiple cloning site"

     primer_bind     1016..1032

                     /note="SK primer"

                     /note="common sequencing primer, one of multiple similar 


     primer_bind     complement(1066..1082)

                     /note="KS primer"

                     /note="common sequencing primer, one of multiple similar 


     polyA_signal    1153..1329

                     /note="CaMV poly(A) signal"

                     /note="cauliflower mosaic virus polyadenylation signal"

     misc_feature    1339..1363

                     /note="RB T-DNA repeat"

                     /note="right border repeat from nopaline C58 T-DNA"

     rep_origin      complement(1454..2042)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(2213..3028)



                     /product="aminoglycoside phosphotransferase"


                     /note="confers resistance to kanamycin in bacteria or G418 

                     (Geneticin(R)) in eukaryotes"






     rep_origin      3319..407

                     /note="pSa ori"

                     /note="origin of replication from bacterial plasmid pSa"


        1 tttttatccc cggaagcctg tggatagagg gtagttatcc acgtgaaacc gctaatgccc

       61 cgcaaagcct tgattcacgg ggctttccgg cccgctccaa aaactatcca cgtgaaatcg

      121 ctaatcaggg tacgtgaaat cgctaatcgg agtacgtgaa atcgctaata aggtcacgtg

      181 aaatcgctaa tcaaaaaggc acgtgagaac gctaatagcc ctttcagatc aacagcttgc

      241 aaacacccct cgctccggca agtagttaca gcaagtagta tgttcaatta gcttttcaat

      301 tatgaatata tatatcaatt attggtcgcc cttggcttgt ggacaatgcg ctacgcgcac

      361 cggctccgcc cgtggacaac cgcaagcggt tgcccaccgt cgagcgccag cgcctttgcc

      421 cacaacccgg cggccggccg caacagatcg ttttataaat tttttttttt gaaaaagaaa

      481 aagcccgaaa ggcggcaacc tctcgggctt ctggatttcc gatccccgga attagagatc

      541 ttggcaggat atattgtggt gtaacgttat cagcttggta cgtacccccc tactccaaaa

      601 atgtcaaaga tacagtctca gaagaccaaa gggctattga gacttttcaa caaagggtaa

      661 tttcgggaaa cctcctcgga ttccattgcc cagctatctg tcacttcatc gaaaggacag

      721 tagaaaagga aggtggctcc tacaaatgcc atcattgcga taaaggaaag gctatcattc

      781 aagatgcctc tgccgacagt ggtcccaaag atggaccccc acccacgagg agcatcgtgg

      841 aaaaagaaga cgttccaacc acgtcttcaa agcaagtgga ttgatgtgac atctccactg

      901 acgtaaggga tgacgcacaa tcccactatc cttcgcaaga cccttcctct atataaggaa

      961 gtcatttcat ttggagagga cagcccaagc tgagctccac cgcggtggcg gccgctctag

     1021 aactagtgga tcccccgggc tgcaggaatt cgatatcaag cttatcgata ccgtcgacct

     1081 cgaggggggg cccggtacca attcggtacg ctgaaatcac cagtctctct ctacaaatct

     1141 atctctctct attttctcca taaataatgt gtgagtagtt tcccgataag ggaaattagg

     1201 gttcttatag ggtttcgctc atgtgttgag catataagaa acccttagta tgtatttgta

     1261 tttgtaaaat acttctatca ataaaatttc taattcctaa aaccaaaatc cagtactaaa

     1321 atccagatcc actagccttg acaggatata ttggcgggta aactaagtcg ctgtatgtgt

     1381 ttgtttgaga tctcatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg

     1441 cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct

     1501 caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa

     1561 gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc

     1621 tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt

     1681 aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg

     1741 ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg

     1801 cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct

     1861 tgaagtggtg gcctaactac ggctacacta gaagaacagt atttggtatc tgcgctctgc

     1921 tgaagccagt taccttcgga agaagagttg gtagctcttg atccggcaaa caaaccaccg

     1981 ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc

     2041 aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt

     2101 aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa

     2161 aatgaagttt taaatcaatc taaagtatat atgtgtaaca ttggtctagt gattagaaaa

     2221 actcatcgag catcaaatga aactgcaatt tattcatatc aggattatca ataccatatt

     2281 tttgaaaaag ccgtttctgt aatgaaggag aaaactcacc gaggcagttc cataggatgg

     2341 caagatcctg gtatcggtct gcgattccga ctcgtccaac atcaatacaa cctattaatt

     2401 tcccctcgtc aaaaataagg ttatcaagtg agaaatcacc atgagtgacg actgaatccg

     2461 gtgagaatgg caaaagttta tgcatttctt tccagacttg ttcaacaggc cagccattac

     2521 gctcgtcatc aaaatcactc gcatcaacca aaccgttatt cattcgtgat tgcgcctgag

     2581 cgagacgaaa tacgcgatcg ctgttaaaag gacaattaca aacaggaatc gaatgcaacc

     2641 ggcgcaggaa cactgccagc gcatcaacaa tattttcacc tgaatcagga tattcttcta

     2701 atacctggaa tgctgttttc cctgggatcg cagtggtgag taaccatgca tcatcaggag

     2761 tacggataaa atgcttgatg gtcggaagag gcataaattc cgtcagccag tttagtctga

     2821 ccatctcatc tgtaacaaca ttggcaacgc tacctttgcc atgtttcaga aacaactctg

     2881 gcgcatcggg cttcccatac aatcggtaga ttgtcgcacc tgattgcccg acattatcgc

     2941 gagcccattt atacccatat aaatcagcat ccatgttgga atttaatcgc ggccttgagc

     3001 aagacgtttc ccgttgaata tggctcataa caccccttgt attactgttt atgtaagcag

     3061 acagttttat tgttcatgat gatatatttt tatcttgtgc aatgtaacat cagagatttt

     3121 gagacacaac gtggctttgt tgaataaatc gaacttttgc tgagttgaag gatcagatca

     3181 cgcatcttcc cgacaacgca gaccgttccg tggcaaagca aaagttcaaa atcaccaact

     3241 ggtccaccta caacaaagct ctcatcaacc gtggctccct cactttctgg ctggatgatg

     3301 gggcgattca ggcgatcccc atccaacagc ccgccgtcga gcgggct


Product is for research use only!


No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
