pGreenIIM DR5v2-ntdTomato-DR5-n3GFP

$232.00

  • Model: PVT17730
  • 50 Units in Stock
Ask a question


Add to Cart:

pGreenIIM DR5v2-ntdTomato-DR5-n3GFP

 

pGreenIIM DR5v2-ntdTomato-DR5-n3GFP Information

Product Name: pGreenIIM DR5v2-ntdTomato-DR5-n3GFP
Cat No.: PVT17730
Alternative Name: pGreenIIM DR5v2-ntdTomato-DR5-n3GFP,pGreenIIM DR5v2-ntdTomato-DR5-n3GFP vector,pGreenIIM DR5v2-ntdTomato-DR5-n3GFP plasmid,pGreenIIM DR5v2-ntdTomato-DR5-n3GFP map,pGreenIIM DR5v2-ntdTomato-DR5-n3GFP sequence
Plasmid form: Freeze-dried powder
Storage Condition: -20 Centigrade
Bulk order Please contact us: sales@lifescience-market.com
Promoter: inquiry
Bacterial Resistance(s): Kan
Screening: inquiry
Growth Strain(s): DH5alpha
Culture Medium: LB
Temperature: 37 Centigrade
Vector Size: 9680bp

 

 

pGreenIIM DR5v2-ntdTomato-DR5-n3GFP Sequence

CCGACAAAAGGCCGACAAAAGGCCGACAAAAGGCCGACAAAAGGCCGACAAAAGGCCGACAAAAGGCCGACAAAAGGCCG
ACAAAAGGCCGACAAAAGGCCGACAAAAGGGGGCAGGCCTCGATAAGCTTGATATCGAATTAATTCCTGCAGCCCCGCAA
GACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGTATTTTTACAACAATTACCAACAACAACAAACAACAAA
CAACATTACAATTACTATTTACAATTACAATTACAGGGGATCCGAAATCCAACTCCATACTGAAGCTTATGGCTCCAAAG
AAGAAGAGAAAGGTCATGGTGAGCAAGGGCGAGGAGGTCATCAAAGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCTC
CATGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGG
TGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCATGTACGGCTCCAAGGCGTACGTGAAG
CACCCCGCCGACATCCCCGATTACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGA
CGGCGGTCTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCACGCTGATCTACAAGGTGAAGATGCGCGGCACCA
ACTTCCCCCCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCGCCTGTACCCCCGCGAC
GGCGTGCTGAAGGGCGAGATCCACCAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGACCATCTA
CATGGCCAAGAAGCCCGTGCAACTGCCCGGCTACTACTACGTGGACACCAAGCTGGACATCACCTCCCACAACGAGGACT
ACACCATCGTGGAACAGTACGAGCGCTCCGAGGGCCGCCACCACCTGTTCCTGGGGCATGGCACCGGCAGCACCGGCAGC
GGCAGCTCCGGCACCGCCTCCTCCGAGGACAACAACATGGCCGTCATCAAAGAGTTCATGCGCTTCAAGGTGCGCATGGA
GGGCTCCATGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGC
TGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCATGTACGGCTCCAAGGCGTAC
GTGAAGCACCCCGCCGACATCCCCGATTACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT
CGAGGACGGCGGTCTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCACGCTGATCTACAAGGTGAAGATGCGCG
GCACCAACTTCCCCCCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCGCCTGTACCCC
CGCGACGGCGTGCTGAAGGGCGAGATCCACCAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGAC
CATCTACATGGCCAAGAAGCCCGTGCAACTGCCCGGCTACTACTACGTGGACACCAAGCTGGACATCACCTCCCACAACG
AGGACTACACCATCGTGGAACAGTACGAGCGCTCCGAGGGCCGCCACCACCTGTTCCTGTACGGCATGGACGAGCTGTAC
AAGTAGCTCGAGAGATCCGATCCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTC
TTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATG
AGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGA
TAAATTATCGCGCGCGGTGTCATCTATGTGAATTCGAGACAAAAGGGAGACAAAAGGGAGACAAAAGGGAGACAAAAGGG
AGACAAAAGGGAGACAAAAGGGAGACAAAAGGGAGACAAAAGGGAGACAAAAGGGAGACAAAAGGGGGCAGGCCTCGATA
AGCTTGATATCGAATTAATTCCTGCAGCCCCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGTAT
TTTTACAACAATTACCAACAACAACAAACAACAAACAACATTACAATTACTATTTACAATTACAATTACAGGGGATCCAT
GGCTCCAAAGAAGAAGAGAAAGGTCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGC
TGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTG
AAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTT
CAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCA
TCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAG
CTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTA
TATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGC
TCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAG
TCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCT
CGGCATGGACGAGCTGTACAAGAGATCCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCG
AGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACC
CTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTG
CTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCA
CCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATC
GAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGT
CTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGC
AGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACC
CAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCAC
TCTCGGCATGGACGAGCTGTACAAGTAAAGATCCAAGGAGATATAACCATGAGTAGTAAAGGAGAAGAACTTTTCACTGG
AGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGGTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATG
CAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACG
TTAACTTATGGAGTACAATGCTTTTCAAGATACCCAGATCATATGAAGCGGCACGACTTCTTCAAGAGCGCCATGCCTGA
GGGATACGTGCAGGAGAGGACCATCTTCTTCAAGGACGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAGGGAG
ACACCCTCGTCAACAGGATCGAGCTTAAGGGAATCGATTTCAAGGAGGACGGAAACATCCTCGGCCACAAGTTGGAATAC
AACTACAACTCCCACAACGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTCAACTTCAAAATTAGACACAA
CATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAG
ACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTT
GTAACAGCTGCTGGGATTACACATGGCATGGATGAATACAAATCTTACGTTACTGTTCCAAACAGAACTAGAACTTACAT
CAAGTAATCTAGATCCGATCCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTT
GCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAG
ATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATA
AATTATCGCGCGCGGTGTCATCTATGTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGG
GTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACA
TACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTG
CCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTAT
TGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAA
AGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGAAGGCCTTGACAGGATATATTGGCGGG
TAAACTAAGTCGCTGTATGTGTTTGTTTGAGATCTCATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGC
CGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAA
ACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTT
ACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGT
GTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATC
GTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTAT
GTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCT
GCTGAAGCCAGTTACCTTCGGAAGAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTT
TTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCT
CAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTA
AAAATGAAGTTTTAAATCAATCTAAAGTATATATGTGTAACATTGGTCTAGTGATTAGAAAAACTCATCGAGCATCAAAT
GAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCA
CCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAA
TTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGTT
TATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTA
TTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAA
CCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTT
TCCCTGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAAT
TCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTC
TGGCGCATCGGGCTTCCCATACAATCGGTAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCAT
ATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTTGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTT
GTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAGATT
TTGAGACACAACGTGGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGCATCTTCCCGACAACG
CAGACCGTTCCGTGGCAAAGCAAAAGTTCAAAATCACCAACTGGTCCACCTACAACAAAGCTCTCATCAACCGTGGCTCC
CTCACTTTCTGGCTGGATGATGGGGCGATTCAGGCGATCCCCATCCAACAGCCCGCCGTCGAGCGGGCTTTTTTATCCCC
GGAAGCCTGTGGATAGAGGGTAGTTATCCACGTGAAACCGCTAATGCCCCGCAAAGCCTTGATTCACGGGGCTTTCCGGC
CCGCTCCAAAAACTATCCACGTGAAATCGCTAATCAGGGTACGTGAAATCGCTAATCGGAGTACGTGAAATCGCTAATAA
GGTCACGTGAAATCGCTAATCAAAAAGGCACGTGAGAACGCTAATAGCCCTTTCAGATCAACAGCTTGCAAACACCCCTC
GCTCCGGCAAGTAGTTACAGCAAGTAGTATGTTCAATTAGCTTTTCAATTATGAATATATATATCAATTATTGGTCGCCC
TTGGCTTGTGGACAATGCGCTACGCGCACCGGCTCCGCCCGTGGACAACCGCAAGCGGTTGCCCACCGTCGAGCGCCTTT
GCCCACAACCCGGCGGCCGGCCGCAACAGATCGTTTTATAAATTTTTTTTTTTGAAAAAGAAAAAGCCCGAAAGGCGGCA
ACCTCTCGGGCTTCTGGATTTCCGATCCCCGGAATTAGATCTTGGCAGGATATATTGTGGTGTAACGTTATCGATCTGGA
TTTTAGTACTGGATTTTGGTTTTAGGAATTAGAAATTTTATTGATAGAAGTATTTTACAAATACAAATACATACTAAGGG
TTTCTTATATGCTCAACACATGAGCGAAACCCTATAAGAACCCTAATTTCCCTTATCGGGAAACTACTCACACATTATTT
ATGGAGAAAATAGAGAGAGATAGATTTGTAGAGAGAGACTGGTGATTTCAGCGTACCGAATTAATTCGAGCTCGGTACCC
CTGGATTTTGGTTTTAGGAATTAGAAATTTTATTGATAGAAGTATTTTACAAATACAAATACATACTAAGGGTTTCTTAT
ATGCTCAACACATGAGCGAAACCCTATAAGAACCCTAATTCCCTTATCTGGGAACTACTCACACATTATTATAGAGAGAG
ATAGATTTGTAGAGAGAGACTGGTGATTTCAGCGGGGGATTCAGCGCCGACGGGACGTAAACAAAGGACGTCCCGCGAAG
GATCTAAAGCCAGCAAAAGTCCCATGGTCTTATAAAAATGCATAGCTTTAGGAGGGGAGCAGAGAACTTGAAAGCATCTT
CCTGTTAGTCTTTCTTCTCGTAGACTTCAAACTTATACTTGATGCCTTTTTCCTCCTGGACCTCAGAGAGGACGCCTGGG
TATTCTGGGAGAAGTTTATATTTCCCCAAATCAATTTCTGGGAAAAACGTGTCACTTTCAAATTCCTGCATGATCCTTGT
CACAAAGAGTCTGAGGTGGCCTGGTTGATTCATGGCTTCCTGGTAAACAGAACTGCCTCCGACTATCCAAACCATGTCTA
CTTTACTTGCCAATTCCGGTTGTTCAATAAGTCTTAAGGCATCATCCAAACTTTTGGCAAGAAAATGAGCTCCTCGTGGT
GGTTCTTTGAGTTCTCTACTGAGAACTATATTAATTCTGTCCTTTAAAGGTCGATTCTTCTCAGGAATGGAGAACCAGGT
TTTCCTACCCATAATCACCAGATTCTGTTTACCTTCCACTGAAGAGGTTGTGGTCATTCTTTGGAAGTACTTGAACTCGT
TCCTGAGCGGAGGCCAGGGTCGGTCTCCGTTCTTGCCAATCCCCATATTTTGGGACACGGCGACGATGCAGTTCAATGGT
CGAACCATGATGGCAAATTCTAGGGGTACCCAGCTTGGGCTGTCCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAA
GGGTCTTGCGAAGGATAGTGGGATTGTGCGTCATCCCTTACGTCAGTGGAGATGTCACATCAATCCACTTGCTTTGAAGA
CGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCAT
CTTGAATGATAGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGAGCCACCTTCCTTTTCTACTGTCCTTTCGATGAAG
TGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCCGAAATTACCCTTTGTTGAAAAGTCTCAATAGCCCTTTGGTC
TTCTGAGACTGTATCTTTGACATTTTTGGAGTAGGGGTACGATAACATTAACGCTTACAATTTCCATTCGCCATTCAGGC
TGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGG
CGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTC
ACTATAGGGCGAATTGGGTACCGGGCCCGTATGGTTAATTAAGACACAGGCGCGCCTAGTTGGAATAGGATTTCGAATTC
//

*Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart