pHB201 Plasmid


  • Model: PVT5013
  • 50 Units in Stock
Ask a question

Add to Cart:


Packing 20ul

Search name
pHB201,Plasmid pHB201,pHB201 vector


pHB201 Information

Promoter: T7, T3

Replicon: ori

Terminator: T1

Plasmid classification: the wide host series, Bacillus subtilis carrier

Plasmid size: 6594bp

Prokaryotic resistance: Chl

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: Bacillus subtilis

Induction mode: IPTG induction

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: primers designed according to sequence

Use: Bacillus subtilis


pHB201 Description

A genomic library of Bacillus lyticus was constructed in lambda GEM 11 vector and screened for the xylanase gene using Congo red plate assay. A 16-kb fragment containing the xylanase gene was obtained which was further subcloned using Mbo I partial digestion in an E. coli pUC 19 vector. A 1.3-kb sub-fragment was obtained which coded for a xylanase gene of Mr 23,650 Da. This fragment was sequenced and the homology was checked with known xylanases. The maximum homology was 97%, which was obtained with an endo xylanase gene from Bacillus species at the DNA level, while the translated sequence showed only one amino acid change from alanine to serine at position number 102. Expression was checked in E. coli, using the native promoter, and an extracellular activity of 5.25 U/mL was obtained. Cloning of the gene was done in Bacillus subtilis using a shuttle vector pHB 201, which resulted in increasing the basal level xylanase activity from 14.02 to 22.01 U/mL.



pHB201 Sequence

LOCUS       Exported File           6594 bp ds-DNA    circular SYN 29-5-2015
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 6594)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-5-29 
FEATURES             Location/Qualifiers
     source          1..6594
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        1533..1551
                     /note="T3 promoter"
                     /note="promoter for bacteriophage T3 RNA polymerase"
     misc_feature    1564..1671
                     /note="pBluescript multiple cloning site"
     primer_bind     1588..1604
                     /note="SK primer"
                     /note="common sequencing primer, one of multiple similar 
     primer_bind     complement(1638..1654)
                     /note="KS primer"
                     /note="common sequencing primer, one of multiple similar 
     promoter        complement(1680..1698)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     primer_bind     complement(1711..1727)
                     /note="M13 fwd"
                     /note="common sequencing primer, one of multiple similar 
     terminator      2073..2159
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB 
     terminator      2251..2278
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB 
     CDS             complement(2717..3367)
     rep_origin      6329..323
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg
       61 gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc
      121 gtgagcattg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa
      181 gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc
      241 tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt
      301 caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct
      361 tttgctggcc ttttgctcac atgttctttc ctgcgttatc ccctgattct gtggataacc
      421 gtattaccgc ctttgagtga gctgataccg ctcgccgcag ccgaacgacc gagcgcagcg
      481 agtcagtgag cgaggaagcg gaagaagctt actttattgt tttgccattt taaaaggttc
      541 aaataaaata tttttcataa aattatcaga tgttttttaa aaaatgaaat aaaagaagaa
      601 aaaaatagaa aatacactaa cccaaagaag cgcgtaatat cgagggttta agagacaata
      661 agaaaaaaag attgaaaaat gacattaaat tcttgacagg gagagatagg tttgatagaa
      721 tataatagtt gtcgcgagag acgacgttga agcgcgacaa gctagaccat tgaaaactga
      781 ataaagaaga atgactcatg tgatgtagca atacatcaaa aatctgtcaa tcaataatga
      841 aagacaagcc atcaattcgg tgacttaaat actttatttg agagtttgat cctctagagt
      901 cgacctgcag gctttaacgt aggcaaagct cagggtagac tttgaatgga cagaaacatg
      961 acatatctct tgaaaggatg attgtggtgg tgaaaacaga taaaatctcc tcctgaatac
     1021 agtaaatcac attcaggagg agataaaatt gtttaaacaa atagacgaaa attatctgcg
     1081 aaaagagcac tttcaccatt atatgacgtt aacccgatgc tcatatagct tggtgatcaa
     1141 tctagacatc acgaaattgc atgcaatatt aaaagaaaaa aagctgaaag tatatcctgt
     1201 gcaaatttat ttgttagcaa gagctgtgca aaaaattcct gagtttcgga tggatcaagt
     1261 gaacgatgaa cttggttact gggagattct ccatcctagt tatacgattc taaataaaga
     1321 aacaaagacg ttttcaagta tttggacgcc ttttgatgaa aactttgctc agttttataa
     1381 aagctgtgta gccgatattg aaacatttag caaaagcagc aacctatttc cgaaacctca
     1441 tatgccagaa aacatgttca atatttcaag tctaccgtgg attgatttta cttcttttaa
     1501 ccttaatgta tctacagatg aagctagcgc gcaattaacc ctcactaaag ggaacaaaag
     1561 ctggagctcc accgcggtgg cggccgctct agaactagtg gatcccccgg gctgcaggaa
     1621 ttcgatatca agcttatcga taccgtcgac ctcgaggggg ggcccggtac ccaattcgcc
     1681 ctatagtgag tcgtattacg cgcgcaattc actggccgtc gttttacaac gtcgtgactg
     1741 ggaaaaccct ggcgttaccc aacttaatcg ccttgcagca catccccctt tcgccagctg
     1801 gcgtaatagc gaagaggccc gcaccgatcg cccttcccaa cagttgcgca gcctgaatta
     1861 gagatcaatt ccctgttttg gcggatgaga gaagattttc agcctgatac agattaaatc
     1921 agaacgcaga agcggtctga taaaacagaa tttgcctggc ggcagtagcg cggtggtccc
     1981 acctgacccc atgccgaact cagaagtgaa acgccgtagc gccgatggta gtgtggggtc
     2041 tccccatgcg agagtaggga actgccaggc atcaaataaa acgaaaggct cagtcgaaag
     2101 actgggcctt tcgttttatc tgttgtttgt cggtgaacgc tctcctgagt aggacaaatc
     2161 cgccgggagc ggatttgaac gttgcgaagc aacggcccgg agggtggcgg gcaggacgcc
     2221 cgccataaac tgccaggcat caaattaagc agaaggccat cctgacggat ggcctttttg
     2281 cgtttctaca aactcttcct gtcgtcatat ctacaagcca tccccccaca gatacggtaa
     2341 actagcctcg tttttgcatc aggaaagcag ggaattgatc tgatgggtag aaccttgggc
     2401 tttgcccaaa cccaccaacg gatggccgtt ggattccaac attcaatccc cccaaccccc
     2461 cgcatctccg gggggctccc tcgccggttg gcgtcaaaca aacgagtttg tttgagtgct
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
