pHiL- D2 Plasmid


  • Model: PVT4033
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT4033  2ug


pHiL-D2 Information

Bacterial Resistance:

Promoter: AOX1

Replicator: pUC ori, FI ori

Plasmid size: 8210bp

Prokaryotic resistance: Amp

Screening markers: HIS4

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: yeast cells

Culture conditions: 28 C, YPD

5'sequencing primers: AOX5:GACTGGTTCCAATTGACAAGC

3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT


pHiL-D2 Description

1. the size of pHIL-D2 carrier is 8210 BP, which is a fusion expression vector.

In the 2. vector construction, the single restriction endonuclease loci available for EcoR I.

The protein gene of 3. intracellular expression.

4. in the process of vector construction, we need to start the gene codon ATG.

5. Pichia pastoris was screened by HIS4.

6. in order to insert the gene into the AOX region of GS115 or KM71, the SacI restrictive endonuclease linearized plasmids (His+Mut+ genotypes in GS115 and His+ MutS genotype in KM71) were used to insert the gene into GS115 or KM71 His4 regions. To produce His+ MutS genotype) insert the gene into the AOX1 region of GS115, and use Bgl II to linearize the plasmid (producing His+MutS genotype).



pHiL-D2 Sequence

LOCUS       Exported                8210 bp ds-DNA     circular SYN 10-SEP-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled 17

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 8210)


  TITLE     Direct Submission

  JOURNAL   Exported Saturday, September 10, 2016 from SnapGene Viewer 3.1.4

FEATURES             Location/Qualifiers

     source          1..8210

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     promoter        14..953

                     /gene="Pichia pastoris AOX1"

                     /note="AOX1 promoter"

                     /note="inducible promoter, regulated by methanol"

     terminator      1031..1277

                     /gene="Pichia pastoris AOX1"

                     /note="AOX1 terminator"

                     /note="transcription terminator for AOX1"

     CDS             complement(1690..4224)


                     /gene="Pichia pastoris HIS4"

                     /product="multifunctional enzyme, required for histidine 



                     /note="auxotrophic marker for Pichia pastoris"
















     misc_feature    4579..5335

                     /note="AOX1 3' fragment"

                     /note="region downstream of Pichia pastoris AOX1 gene"

     promoter        5582..5686


                     /note="AmpR promoter"

     CDS             5687..6547





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     rep_origin      complement(6589..7044)


                     /note="f1 ori"

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"

     rep_origin      7155..7743



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     misc_feature    7929..8069


                     /note="basis of mobility region from pBR322"


        1 agatcgcggc cgcgatctaa catccaaaga cgaaaggttg aatgaaacct ttttgccatc

       61 cgacatccac aggtccattc tcacacataa gtgccaaacg caacaggagg ggatacacta

      121 gcagcagacc gttgcaaacg caggacctcc actcctcttc tcctcaacac ccacttttgc

      181 catcgaaaaa ccagcccagt tattgggctt gattggagct cgctcattcc aattccttct

      241 attaggctac taacaccatg actttattag cctgtctatc ctggcccccc tggcgaggtc

      301 atgtttgttt atttccgaat gcaacaagct ccgcattaca cccgaacatc actccagatg

      361 agggctttct gagtgtgggg tcaaatagtt tcatgttccc aaatggccca aaactgacag

      421 tttaaacgct gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa

      481 gtttggttcg ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcgcca

      541 taccgtttgt cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt

      601 agcgcagtct ctctatcgct tctgaacccg gtggcacctg tgccgaaacg caaatgggga

      661 aacaacccgc tttttggatg attatgcatt gtcctccaca ttgtatgctt ccaagattct

      721 ggtgggaata ctgctgatag cctaacgttc atgatcaaaa tttaactgtt ctaaccccta

      781 cttgacaggc aatatataaa cagaaggaag ctgccctgtc ttaaaccttt ttttttatca

      841 tcattattag cttactttca taattgcgac tggttccaat tgacaagctt ttgattttaa

      901 cgacttttaa cgacaacttg agaagatcaa aaaacaacta attattcgaa acgaggaatt

      961 cgccttagac atgactgttc ctcagttcaa gttgggcact tacgagaaga ccggtcttgc

     1021 tagattctaa tcaagaggat gtcagaatgc catttgcctg agagatgcag gcttcatttt

     1081 tgatactttt ttatttgtaa cctatatagt ataggatttt ttttgtcatt ttgtttcttc

     1141 tcgtacgagc ttgctcctga tcagcctatc tcgcagctga tgaatatctt gtggtagggg

     1201 tttgggaaaa tcattcgagt ttgatgtttt tcttggtatt tcccactcct cttcagagta

     1261 cagaagatta agtgagaagt tcgtttgtgc aagcttatcg ataagcttta atgcggtagt

     1321 ttatcacagt taaattgcta acgcagtcag gcaccgtgta tgaaatctaa caatgcgctc

     1381 atcgtcatcc tcggcaccgt caccctggat gctgtaggca taggcttggt tatgccggta

     1441 ctgccgggcc tcttgcggga tatcgtccat tccgacagca tcgccagtca ctatggcgtg

     1501 ctgctagcgc tatatgcgtt gatgcaattt ctatgcgcac ccgttctcgg agcactgtcc

     1561 gaccgctttg gccgccgccc agtcctgctc gcttcgctac ttggagccac tatcgactac

     1621 gcgatcatgg cgaccacacc cgtcctgtgg atctatcgaa tctaaatgta agttaaaatc

     1681 tctaaataat taaataagtc ccagtttctc catacgaacc ttaacagcat tgcggtgagc

     1741 atctagacct tcaacagcag ccagatccat cactgcttgg ccaatatgtt tcagtccctc

     1801 aggagttacg tcttgtgaag tgatgaactt ctggaaggtt gcagtgttaa ctccgctgta

     1861 ttgacgggca tatccgtacg ttggcaaagt gtggttggta ccggaggagt aatctccaca

     1921 actctctgga gagtaggcac caacaaacac agatccagcg tgttgtactt gatcaacata

     1981 agaagaagca ttctcgattt gcaggatcaa gtgttcagga gcgtactgat tggacatttc

     2041 caaagcctgc tcgtaggttg caaccgatag ggttgtagag tgtgcaatac acttgcgtac

     2101 aatttcaacc cttggcaact gcacagcttg gttgtgaaca gcatcttcaa ttctggcaag

     2161 ctccttgtct gtcatatcga cagccaacag aatcacctgg gaatcaatac catgttcagc

     2221 ttgagacaga aggtctgagg caacgaaatc tggatcagcg tatttatcag caataactag

     2281 aacttcagaa ggcccagcag gcatgtcaat actacacagg gctgatgtgt cattttgaac

     2341 catcatcttg gcagcagtaa cgaactggtt tcctggacca aatattttgt cacacttagg

     2401 aacagtttct gttccgtaag ccatagcagc tactgcctgg gcgcctcctg ctagcacgat

     2461 acacttagca ccaaccttgt gggcaacgta gatgacttct ggggtaaggg taccatcctt

     2521 cttaggtgga gatgcaaaaa caatttcttt gcaaccagca actttggcag gaacacccag

     2581 catcagggaa gtggaaggca gaattgcggt tccaccagga atatagaggc caactttctc

     2641 aataggtctt gcaaaacgag agcagactac accagggcaa gtctcaactt gcaacgtctc

     2701 cgttagttga gcttcatgga atttcctgac gttatctata gagagatcaa tggctctctt

     2761 aacgttatct ggcaattgca taagttcctc tgggaaagga gcttctaaca caggtgtctt

     2821 caaagcgact ccatcaaact tggcagttag ttctaaaagg gctttgtcac cattttgacg

     2881 aacattgtcg acaattggtt tgactaattc cataatctgt tccgttttct ggataggacg

     2941 acgaagggca tcttcaattt cttgtgagga ggccttagaa acgtcaattt tgcacaattc

     3001 aatacgacct tcagaaggga cttctttagg tttggattct tctttaggtt gttccttggt

     3061 gtatcctggc ttggcatctc ctttccttct agtgaccttt agggacttca tatccaggtt

     3121 tctctccacc tcgtccaacg tcacaccgta cttggcacat ctaactaatg caaaataaaa

     3181 taagtcagca cattcccagg ctatatcttc cttggattta gcttctgcaa gttcatcagc

     3241 ttcctcccta attttagcgt tcaacaaaac ttcgtcgtca aataaccgtt tggtataaga

     3301 accttctgga gcattgctct tacgatccca caaggtggct tccatggctc taagaccctt

     3361 tgattggcca aaacaggaag tgcgttccaa gtgacagaaa ccaacacctg tttgttcaac

     3421 cacaaatttc aagcagtctc catcacaatc caattcgata cccagcaact tttgagttgc

     3481 tccagatgta gcacctttat accacaaacc gtgacgacga gattggtaga ctccagtttg

     3541 tgtccttata gcctccggaa tagacttttt ggacgagtac accaggccca acgagtaatt

     3601 agaagagtca gccaccaaag tagtgaatag accatcgggg cggtcagtag tcaaagacgc

     3661 caacaaaatt tcactgacag ggaacttttt gacatcttca gaaagttcgt attcagtagt

     3721 caattgccga gcatcaataa tggggattat accagaagca acagtggaag tcacatctac

     3781 caactttgcg gtctcagaaa aagcataaac agttctacta ccgccattag tgaaactttt

     3841 caaatcgccc agtggagaag aaaaaggcac agcgatacta gcattagcgg gcaaggatgc

     3901 aactttatca accagggtcc tatagataac cctagcgcct gggatcatcc tttggacaac

     3961 tctttctgcc aaatctaggt ccaaaatcac ttcattgata ccattattgt acaacttgag

     4021 caagttgtcg atcagctcct caaattggtc ctctgtaacg gatgactcaa cttgcacatt

     4081 aacttgaagc tcagtcgatt gagtgaactt gatcaggttg tgcagctggt cagcagcata

     4141 gggaaacacg gcttttccta ccaaactcaa ggaattatca aactctgcaa cacttgcgta

     4201 tgcaggtagc aagggaaatg tcatacttga agtcggacag tgagtgtagt cttgagaaat

     4261 tctgaagccg tatttttatt atcagtgagt cagtcatcag gagatcctct acgccggacg

     4321 catcgtggcc ggcatcaccg gcgccacagg tgcggttgct ggcgcctata tcgccgacat

     4381 caccgatggg gaagatcggg ctcgccactt cgggctcatg agcgcttgtt tcggcgtggg

     4441 tatggtggca ggccccgtgg ccgggggact gttgggcgcc atctccttgc atgcaccatt

     4501 ccttgcggcg gcggtgctca acggcctcaa cctactactg ggctgcttcc taatgcagga

     4561 gtcgcataag ggagagcgtc gagtatctat gattggaagt atgggaatgg tgatacccgc

     4621 attcttcagt gtcttgaggt ctcctatcag attatgccca actaaagcaa ccggaggagg

     4681 agatttcatg gtaaatttct ctgacttttg gtcatcagta gactcgaact gtgagactat

     4741 ctcggttatg acagcagaaa tgtccttctt ggagacagta aatgaagtcc caccaataaa

     4801 gaaatccttg ttatcaggaa caaacttctt gtttcgaact ttttcggtgc cttgaactat

     4861 aaaatgtaga gtggatatgt cgggtaggaa tggagcgggc aaatgcttac cttctggacc

     4921 ttcaagaggt atgtagggtt tgtagatact gatgccaact tcagtgacaa cgttgctatt

     4981 tcgttcaaac cattccgaat ccagagaaat caaagttgtt tgtctactat tgatccaagc

     5041 cagtgcggtc ttgaaactga caatagtgtg ctcgtgtttt gaggtcatct ttgtatgaat

     5101 aaatctagtc tttgatctaa ataatcttga cgagccaagg cgataaatac ccaaatctaa

     5161 aactctttta aaacgttaaa aggacaagta tgtctgcctg tattaaaccc caaatcagct

     5221 cgtagtctga tcctcatcaa cttgaggggc actatcttgt tttagagaaa tttgcggaga

     5281 tgcgatatcg agaaaaaggt acgctgattt taaacgtgaa atttatctca agatcgcggc

     5341 cgcgatctcg aataataact gttatttttc agtgttcccg atctgcgtct atttcacaat

     5401 accaacatga gtcagcttat cgatgataag ctgtcaaaca tgagaattaa ttcgatgata

     5461 agctgtcaaa catgagaaat cttgaagacg aaagggcctc gtgatacgcc tatttttata

     5521 ggttaatgtc atgataataa tggtttctta gacgtcaggt ggcacttttc ggggaaatgt

     5581 gcgcggaacc cctatttgtt tatttttcta aatacattca aatatgtatc cgctcatgag

     5641 acaataaccc tgataaatgc ttcaataata ttgaaaaagg aagagtatga gtattcaaca

     5701 tttccgtgtc gcccttattc ccttttttgc ggcattttgc cttcctgttt ttgctcaccc

     5761 agaaacgctg gtgaaagtaa aagatgctga agatcagttg ggtgcacgag tgggttacat

     5821 cgaactggat ctcaacagcg gtaagatcct tgagagtttt cgccccgaag aacgttttcc

     5881 aatgatgagc acttttaaag ttctgctatg tggcgcggta ttatcccgtg ttgacgccgg

     5941 gcaagagcaa ctcggtcgcc gcatacacta ttctcagaat gacttggttg agtactcacc

     6001 agtcacagaa aagcatctta cggatggcat gacagtaaga gaattatgca gtgctgccat

     6061 aaccatgagt gataacactg cggccaactt acttctgaca acgatcggag gaccgaagga

     6121 gctaaccgct tttttgcaca acatggggga tcatgtaact cgccttgatc gttgggaacc

     6181 ggagctgaat gaagccatac caaacgacga gcgtgacacc acgatgcctg cagcaatggc

     6241 aacaacgttg cgcaaactat taactggcga actacttact ctagcttccc ggcaacaatt

     6301 aatagactgg atggaggcgg ataaagttgc aggaccactt ctgcgctcgg cccttccggc

     6361 tggctggttt attgctgata aatctggagc cggtgagcgt gggtctcgcg gtatcattgc

     6421 agcactgggg ccagatggta agccctcccg tatcgtagtt atctacacga cggggagtca

     6481 ggcaactatg gatgaacgaa atagacagat cgctgagata ggtgcctcac tgattaagca

     6541 ttggtaactg tcagaccaag tttactcata tatactttag attgatttaa attgtaaacg

     6601 ttaatatttt gttaaaattc gcgttaaatt tttgttaaat cagctcattt tttaaccaat

     6661 aggccgaaat cggcaaaatc ccttataaat caaaagaata gaccgagata gggttgagtg

     6721 ttgttccagt ttggaacaag agtccactat taaagaacgt ggactccaac gtcaaagggc

     6781 gaaaaaccgt ctatcagggc gatggcccac tacgtgaacc atcaccctaa tcaagttttt

     6841 tggggtcgag gtgccgtaaa gcactaaatc ggaaccctaa agggagcccc cgatttagag

     6901 cttgacgggg aaagccggcg aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg

     6961 gcgctagggc gctggcaagt gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc

     7021 ttaatgcgcc gctacagggc gcgtaaaagg atctaggtga agatcctttt tgataatctc

     7081 atgaccaaaa tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag

     7141 atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa

     7201 aaaccaccgc taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg

     7261 aaggtaactg gcttcagcag agcgcagata ccaaatactg tccttctagt gtagccgtag

     7321 ttaggccacc acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg

     7381 ttaccagtgg ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga

     7441 tagttaccgg ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc

     7501 ttggagcgaa cgacctacac cgaactgaga tacctacagc gtgagcattg agaaagcgcc

     7561 acgcttcccg aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga

     7621 gagcgcacga gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt

     7681 cgccacctct gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg

     7741 aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac

     7801 atgttctttc ctgcgttatc ccctgattct gtggataacc gtattaccgc ctttgagtga

     7861 gctgataccg ctcgccgcag ccgaacgacc gagcgcagcg agtcagtgag cgaggaagcg

     7921 gaagagcgcc tgatgcggta ttttctcctt acgcatctgt gcggtatttc acaccgcata

     7981 tggtgcactc tcagtacaat ctgctctgat gccgcatagt taagccagta tacactccgc

     8041 tatcgctacg tgactgggtc atggctgcgc cccgacaccc gccaacaccc gctgacgcgc

     8101 cctgacgggc ttgtctgctc ccggcatccg cttacagaca agctgtgacc gtctccggga

     8161 gctgcatgtg tcagaggttt tcaccgtcat caccgaaacg cgcgaggcag



Search name

pHiL-D2,Plasmid pHiL-D2,pHiL-D2 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
