pHiL- S1 Plasmid


  • Model: PVT4032
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pHiL-S1,Plasmid pHiL-S1,pHiL-S1 vector



pHiL-S1 Information

Promoter: AOX1

Replicon: pUC ori, FI ori

Plasmid classification: yeast series, Pichia pastoris expression vector

Plasmid size: 8260bp

Prokaryotic resistance: Amp

Selection marker: HIS4

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: yeast cells

5'sequencing primers: AOX5:GACTGGTTCCAATTGACAAGC

3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT


pHiL-S1 Description

1. the size of pHIL-S1 carrier is 8260 BP, which is a fusion expression vector.

2. In the process of vector construction, the single restriction enzyme sites are Xho I, EcoR I, Sma I, BamH I.

3. secreting signal peptide by PHO1, secreting the expressed protein gene.

4. During the construction of the vector, your genes must be read in the same frame as the starting codon of the signal peptide.

5. Pichia pastoris was screened by HIS4.

6. In order to insert the gene into the AOX region of GS115 or KM71, the SacI restriction endonuclease linearization plasmid (GS115 produces his + Mut + genotype, KM71 produces his + MutS genotype)

7. In order to insert the gene into the HIS 4 region of GS115 or KM71, a Sal I or Stu I restriction endonuclease linearized plasmid (GS115 produces his + Mut + genotype, KM71 produces his + MutS genotype)

8. inserting genes into the AOX1 region of GS115 requires the use of Bgl II linearization plasmid (producing His+MutS genotype).


pHiL-S1 Multiple cloning site




pHiL-S1 Sequence

LOCUS       Exported                8260 bp ds-DNA     circular SYN 10-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 16
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 8260)
  TITLE     Direct Submission
  JOURNAL   Exported Saturday, September 10, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..8260
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        2..941
                     /gene="Pichia pastoris AOX1"
                     /note="AOX1 promoter"
                     /note="inducible promoter, regulated by methanol"
     CDS             942..1007
                     /product="signal sequence from a secreted acid phosphatase 
                     of Pichia pastoris"
                     /note="PHO1 signal sequence"
                     /note="synthetic gene fragment"
     terminator      1093..1339
                     /gene="Pichia pastoris AOX1"
                     /note="AOX1 terminator"
                     /note="transcription terminator for AOX1"
     CDS             complement(1752..4286)
                     /gene="Pichia pastoris HIS4"
                     /product="multifunctional enzyme, required for histidine 
                     /note="auxotrophic marker for Pichia pastoris"
     misc_feature    4641..5397
                     /note="AOX1 3' fragment"
                     /note="region downstream of Pichia pastoris AOX1 gene"
     misc_feature    5540..5680
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(5866..6454)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     rep_origin      6565..7020
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     CDS             complement(7062..7922)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(7923..8027)
                     /note="AmpR promoter"
        1 agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag
       61 gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt
      121 tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc
      181 agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta
      241 acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggtcat gtttgtttat
      301 ttccgaatgc aacaagctcc gcattacacc cgaacatcac tccagatgag ggctttctga
      361 gtgtggggtc aaatagtttc atgttcccaa atggcccaaa actgacagtt taaacgctgt
      421 cttggaacct aatatgacaa aagcgtgatc tcatccaaga tgaactaagt ttggttcgtt
      481 gaaatgctaa cggccagttg gtcaaaaaga aacttccaaa agtcgccata ccgtttgtct
      541 tgtttggtat tgattgacga atgctcaaaa ataatctcat taatgcttag cgcagtctct
      601 ctatcgcttc tgaacccggt ggcacctgtg ccgaaacgca aatggggaaa caacccgctt
      661 tttggatgat tatgcattgt cctccacatt gtatgcttcc aagattctgg tgggaatact
      721 gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacaggcaa
      781 tatataaaca gaaggaagct gccctgtctt aaaccttttt ttttatcatc attattagct
      841 tactttcata attgcgactg gttccaattg acaagctttt gattttaacg acttttaacg
      901 acaacttgag aagatcaaaa aacaactaat tattcgaaac gatgttctct ccaattttgt
      961 ccttggaaat tattttagct ttggctactt tgcaatctgt cttcgctcga gaattccccg
     1021 ggatccttag acatgactgt tcctcagttc aagttgggca cttacgagaa gaccggtctt
     1081 gctagattct aatcaagagg atgtcagaat gccatttgcc tgagagatgc aggcttcatt
     1141 tttgatactt ttttatttgt aacctatata gtataggatt ttttttgtca ttttgtttct
     1201 tctcgtacga gcttgctcct gatcagccta tctcgcagct gatgaatatc ttgtggtagg
     1261 ggtttgggaa aatcattcga gtttgatgtt tttcttggta tttcccactc ctcttcagag
     1321 tacagaagat taagtgagaa gttcgtttgt gcaagcttat cgataagctt taatgcggta
     1381 gtttatcaca gttaaattgc taacgcagtc aggcaccgtg tatgaaatct aacaatgcgc
     1441 tcatcgtcat cctcggcacc gtcaccctgg atgctgtagg cataggcttg gttatgccgg
     1501 tactgccggg cctcttgcgg gatatcgtcc attccgacag catcgccagt cactatggcg
     1561 tgctgctagc gctatatgcg ttgatgcaat ttctatgcgc acccgttctc ggagcactgt
     1621 ccgaccgctt tggccgccgc ccagtcctgc tcgcttcgct acttggagcc actatcgact
     1681 acgcgatcat ggcgaccaca cccgtcctgt ggatctatcg aatctaaatg taagttaaaa
     1741 tctctaaata attaaataag tcccagtttc tccatacgaa ccttaacagc attgcggtga
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
