PiggyBac Dual promoter (PB513B- 1)


  • Model: PVT10876
  • 50 Units in Stock
Ask a question

Add to Cart:

PiggyBac Dual promoter (PB513B-1)

Catalog No. PVT10876
Packing 2ug
Function Mammal Editing plasmids

PiggyBac Dual promoter (PB513B-1) Informaiton

Promoter: CMV promoter

Replicator: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid classification: lactation serial plasmids, lactation editing plasmids, suckling transposable plasmid.

Plasmid size: 7258bp

Prokaryotic resistance: ampicillin Amp (100 u g/ml)

Screening markers: green fluorescent protein CopGFP and puromycin Puro (10ug/ml).

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic LB

Expression host: mammalian cells such as 293T

Culture conditions: 37 C, 5%CO2

Induction mode: no induction, instantaneous expression

5'sequencing primers: CMV-F (CGCAAATGGGCGGTAGGCGTG)

3'sequencing primers: Sv40-polyA-R (GAAATTTGTGATGCTATTGC)


PiggyBac Dual promoter (PB513B-1) Decription

  PiggyBac Dual promoter (PB513B-1) is a plasmid for a mammalian cell transposing experiment, and a polyclonal site (MCS) located downstream of the CMV promoter, making the target gene or microRNA more convenient to clone. The downstream EF-1 alpha core promoter starts the expression of GFP.
  The PiggyBac (PB) transposon is a mobile genetic element that efficiently transposes between vectors and chromosomes via a "cut and paste" mechanism. During transposition, the PB transposase recognizes transposon-specific inverted terminal repeat sequences (ITRs) located on both ends of the transposon vector and efficiently moves the contents from the original sites and efficiently integrates them into TTAA chromosomal sites. The powerful activity of the piggyBac transposon system enables genes of interest between the two ITRs in the PB vector to be easily mobilized into target genomes.
   The unique features of piggyBac transposons are that there is NO Cargo Limit and it is also Reversible. Genomes containing an inserted piggyBac vector can be transiently re-transfected with the PB transposase expression vector. The PB transposase will remove the transposons from the genome, footprint-free.The Super PiggyBac transposase transient expression vector and PB513B-1 were co-transfected into HeLa cells and puromycin selection applied for 10 days (10ug/ml). Cells efficiently transposed were Puro resistant and GFP positive.




PiggyBac Dual promoter (PB513B-1) Sequence

LOCUS       Exported File           7258 bp ds-DNA    circular SYN 24-5-2015

KEYWORDS    PiggyBac Dual promoter(PB513B-1)

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 7258)

  TITLE     Direct Submission

  JOURNAL   Exported 2015-5-24

FEATURES             Location/Qualifiers

     source          1..7258

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     promoter        complement(1..105)


                     /note="AmpR promoter"

     rep_origin      complement(131..586)


                     /note="f1 ori"

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"

     primer_bind     728..744

                     /note="M13 fwd"

                     /note="common sequencing primer, one of multiple similar 


     promoter        1442..1645

                     /note="CMV promoter"

                     /note="human cytomegalovirus (CMV) immediate early 


     CDS             3068..3121


                     /product="2A peptide from?Thosea asigna virus capsid 



                     /note="Eukaryotic ribosomes fail to insert a peptide bond 

                     between the Gly and Pro residues, yielding separate 





     CDS             3122..3721


                     /gene="pac from Streptomyces alboniger"

                     /product="puromycin N-acetyltransferase"


                     /note="confers resistance to puromycin"





     polyA_signal    3829..3950

                     /note="SV40 poly(A) signal"

                     /note="SV40 polyadenylation signal"

     primer_bind     complement(5237..5253)

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     protein_bind    5261..5277

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     promoter        complement(5285..5315)

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    5330..5351

                     /bound_moiety="E. coli catabolite activator protein"

                     /note="CAP binding site"

                     /note="CAP binding activates transcription in the presence 

                     of cAMP."

     rep_origin      complement(5639..6227)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(6398..7258)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"








        1 actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata

       61 catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa

      121 agtgccacct aaattgtaag cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa

      181 atcagctcat tttttaacca ataggccgaa atcggcaaaa tcccttataa atcaaaagaa

      241 tagaccgaga tagggttgag tgttgttcca gtttggaaca agagtccact attaaagaac

      301 gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa

      361 ccatcaccct aatcaagttt tttggggtcg aggtgccgta aagcactaaa tcggaaccct

      421 aaagggagcc cccgatttag agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa

      481 gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc

      541 gtaaccacca cacccgccgc gcttaatgcg ccgctacagg gcgcgtccca ttcgccattc

      601 aggctgcgca actgttggga agggcgatcg gtgcgggcct cttcgctatt acgccagctg

      661 gcgaaagggg gatgtgctgc aaggcgatta agttgggtaa cgccagggtt ttcccagtca

      721 cgacgttgta aaacgacggc cagtgagcgc gcctcgttca ttcacgtttt tgaacccgtg

      781 gaggacgggc agactcgcgg tgcaaatgtg ttttacagcg tgatggagca gatgaagatg

      841 ctcgacacgc tgcagaacac gcagctagat taaccctaga aagataatca tattgtgacg

      901 tacgttaaag ataatcatgc gtaaaattga cgcatgtgtt ttatcggtct gtatatcgag

      961 gtttatttat taatttgaat agatattaag ttttattata tttacactta catactaata

     1021 ataaattcaa caaacaattt atttatgttt atttatttat taaaaaaaaa caaaaactca

     1081 aaatttcttc tataaagtaa caaaactttt atgagggaca gccccccccc aaagccccca

     1141 gggatgtaat tacgtccctc ccccgctagg gggcagcagc gagccgcccg gggctccgct

     1201 ccggtccggc gctccccccg catccccgag ccggcagcgt gcggggacag cccgggcacg

     1261 gggaaggtgg cacgggatcg ctttcctctg aacgcttctc gctgctcttt gagcctgcag

     1321 acacctgggg ggatacgggg aaaaggcctc caaggcctac tagtattatg cccagtacat

     1381 gaccttatgg gactttccta cttggcagta catctacgta ttagtcatcg ctattaccat

     1441 ggtgatgcgg ttttggcagt acatcaatgg gcgtggatag cggtttgact cacggggatt

     1501 tccaagtctc caccccattg acgtcaatgg gagtttgttt tggcaccaaa atcaacggga

     1561 ctttccaaaa tgtcgtaaca actccgcccc attgacgcaa atgggcggta ggcgtgtacg

     1621 gtgggaggtc tatataagca gagctcgttt agtgaaccgt cagatcgcct ggagacgcca

     1681 tccacgctgt tttgacctcc atagaagatt ctagagctag cgaattcgaa tttaaatcgg

     1741 atccgcggcc gcaaggatct gcgatcgctc cggtgcccgt cagtgggcag agcgcacatc

     1801 gcccacagtc cccgagaagt tggggggagg ggtcggcaat tgaacgggtg cctagagaag

     1861 gtggcgcggg gtaaactggg aaagtgatgt cgtgtactgg ctccgccttt ttcccgaggg

     1921 tgggggagaa ccgtatataa gtgcagtagt cgccgtgaac gttctttttc gcaacgggtt

     1981 tgccgccaga acacagctga agcttcgagg ggctcgcatc tctccttcac gcgcccgccg

     2041 ccctacctga ggccgccatc cacgccggtt gagtcgcgtt ctgccgcctc ccgcctgtgg

     2101 tgcctcctga actgcgtccg ccgtctaggt aagtttaaag ctcaggtcga gaccgggcct

     2161 ttgtccggcg ctcccttgga gcctacctag actcagccgg ctctccacgc tttgcctgac

     2221 cctgcttgct caactctacg tctttgtttc gttttctgtt ctgcgccgtt acagatccaa

     2281 gctgtgaccg gcgcctacgc tagacgccac catggagagc gacgagagcg gcctgcccgc

     2341 catggagatc gagtgccgca tcaccggcac cctgaacggc gtggagttcg agctggtggg

     2401 cggcggagag ggcaccccca agcagggccg catgaccaac aagatgaaga gcaccaaagg

     2461 cgccctgacc ttcagcccct acctgctgag ccacgtgatg ggctacggct tctaccactt

     2521 cggcacctac cccagcggct acgagaaccc cttcctgcac gccatcaaca acggcggcta

     2581 caccaacacc cgcatcgaga agtacgagga cggcggcgtg ctgcacgtga gcttcagcta

     2641 ccgctacgag gccggccgcg tgatcggcga cttcaaggtg gtgggcaccg gcttccccga

     2701 ggacagcgtg atcttcaccg acaagatcat ccgcagcaac gccaccgtgg agcacctgca

     2761 ccccatgggc gataacgtgc tggtgggcag cttcgcccgc accttcagcc tgcgcgacgg

     2821 cggctactac agcttcgtgg tggacagcca catgcacttc aagagcgcca tccaccccag

     2881 catcctgcag aacgggggcc ccatgttcgc cttccgccgc gtggaggagc tgcacagcaa

     2941 caccgagctg ggcatcgtgg agtaccagca cgccttcaag acccccatcg ccttcgccag

     3001 atcccgcgct cagtcgtcca attctgccgt ggacggcacc gccggacccg gctccaccgg

     3061 atctcgcgag ggcagaggaa gtcttctaac atgcggtgac gtggaggaga atcccggccc

     3121 tatgaccgag tacaagccca cggtgcgcct cgccacccgc gacgacgtcc ccagggccgt

     3181 acgcaccctc gccgccgcgt tcgccgacta ccccgccacg cgccacaccg tcgatccgga

     3241 ccgccacatc gagcgggtca ccgagctgca agaactcttc ctcacgcgcg tcgggctcga

     3301 catcggcaag gtgtgggtcg cggacgacgg cgccgcggtg gcggtctgga ccacgccgga

     3361 gagcgtcgaa gcgggggcgg tgttcgccga gatcggcccg cgcatggccg agttgagcgg

     3421 ttcccggctg gccgcgcagc aacagatgga aggcctcctg gcgccgcacc ggcccaagga

     3481 gcccgcgtgg ttcctggcca ccgtcggcgt ctcgcccgac caccagggca agggtctggg

     3541 cagcgccgtc gtgctccccg gagtggaggc ggccgagcgc gccggggtgc ccgccttcct

     3601 ggagacctcc gcgccccgca acctcccctt ctacgagcgg ctcggcttca ccgtcaccgc

     3661 cgacgtcgag gtgcccgaag gaccgcgcac ctggtgcatg acccgcaagc ccggtgcctg

     3721 aaatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc

     3781 tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcagttaa cttgtttatt

     3841 gcagcttata atggttacaa ataaagcaat agcatcacaa atttcacaaa taaagcattt

     3901 ttttcactgc attctagttg tggtttgtcc aaactcatca atgtatctta tcatgtctgg

     3961 aattgactca aatgatgtca attagtctat cagaagctat ctggtctccc ttccggggga

     4021 caagacatcc ctgtttaata tttaaacagc agtgttccca aactgggttc ttatatccct

     4081 tgctctggtc aaccaggttg cagggtttcc tgtcctcaca ggaacgaagt ccctaaagaa

     4141 acagtggcag ccaggtttag ccccggaatt gactggattc cttttttagg gcccattggt

     4201 atggcttttt ccccgtatcc ccccaggtgt ctgcaggctc aaagagcagc gagaagcgtt

     4261 cagaggaaag cgatcccgtg ccaccttccc cgtgcccggg ctgtccccgc acgctgccgg

     4321 ctcggggatg cggggggagc gccggaccgg agcggagccc cgggcggctc gctgctgccc

     4381 cctagcgggg gagggacgta attacatccc tgggggcttt gggggggggc tgtccctgat

     4441 atctataaca agaaaatata tatataataa gttatcacgt aagtagaaca tgaaataaca

     4501 atataattat cgtatgagtt aaatcttaaa agtcacgtaa aagataatca tgcgtcattt

     4561 tgactcacgc ggtcgttata gttcaaaatc agtgacactt accgcattga caagcacgcc

     4621 tcacgggagc tccaagcggc gactgagatg tcctaaatgc acagcgacgg attcgcgcta

     4681 tttagaaaga gagagcaata tttcaagaat gcatgcgtca attttacgca gactatcttt

     4741 ctagggttaa tctagctgca tcaggatcat atcgtcgggt cttttttccg gctcagtcat

     4801 cgcccaagct ggcgctatct gggcatcggg gaggaagaag cccgtgcctt ttcccgcgag

     4861 gttgaagcgg catggaaaga gtttgccgag gatgactgct gctgcattga cgttgagcga

     4921 aaacgcacgt ttaccatgat gattcgggaa ggtgtggcca tgcacgcctt taacggtgaa

     4981 ctgttcgttc aggccacctg ggataccagt tcgtcgcggc ttttccggac acagttccgg

     5041 atggtcagcc cgaagcgcat cagcaacccg aacaataccg gcgacagccg gaactgccgt

     5101 gccggtgtgc agattaatga cagcggtgcg gcgctgggat attacgtcag cgaggacggg

     5161 tatcctggct ggatgccgca gaaatggaca tggatacccc gtgagttacc cggcgggcgc

     5221 gcttggcgta atcatggtca tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc

     5281 cacacaacat acgagccgga agcataaagt gtaaagcctg gggtgcctaa tgagtgagct

     5341 aactcacatt aattgcgttg cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc

     5401 agctgcatta atgaatcggc caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt

     5461 ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag

     5521 ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca

     5581 tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt

     5641 tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc

     5701 gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct

     5761 ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg

     5821 tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca

     5881 agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact

     5941 atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta

     6001 acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta

     6061 actacggcta cactagaagg acagtatttg gtatctgcgc tctgctgaag ccagttacct

     6121 tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt

     6181 tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga

     6241 tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca

     6301 tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat

     6361 caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg

     6421 cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt

     6481 agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag

     6541 acccacgctc accggctcca gatttatcag caataaacca gccagccgga agggccgagc

     6601 gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag

     6661 ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctacaggca

     6721 tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa

     6781 ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga

     6841 tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata

     6901 attctcttac tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca

     6961 agtcattctg agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaatacggg

     7021 ataataccgc gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg

     7081 ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg

     7141 cacccaactg atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag

     7201 gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcat



Product is for  research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
