pIRES2- EGFP Plasmid


  • Model: PVT1228
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pIRES2-EGFP,Plasmid pIRES2-EGFP,pIRES2-EGFP vector


pIRES2-EGFP Informaiton

Promoter: CMV

Replicon: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid classification: mammalian cells, fluorescent protein reporter vectors

Plasmid size: 5308bp

Prokaryotic resistance: Kan

Selection marker: Neo

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: lactation cells

Induction mode: no need to induce, transient expression.


3'sequencing primers: pEGFP-N-3:CGTCGCCGTCCAGCTCGACCAG


pIRES2-EGFP Sequence

pIRES2-EGFP contains the internal ribosome entry site (IRES; 1, 2) of the encephalomyocarditis virus (ECMV) between the MCS and the enhanced green fluorescent protein (EGFP) coding region.This permits both the gene of interest (cloned into the MCS) and the EGFP gene to be translated from a single bicistronic mRNA. pIRES2-EGFP is designed for the efficient selection (by flow cytometry or other methods) of transiently transfected mammalian cells expressing EGFP and the protein of interest. This vector can also be used to express EGFP alone or to obtain stably transfected cell lines without time-consuming drug and clonal selection.


pIRES2-EGFP Multiple cloning site





pIRES2-EGFP Sequence

LOCUS       Exported                5308 bp ds-DNA     circular SYN 31-AUG-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5308)
  AUTHORS   admin
  TITLE     Direct Submission
  JOURNAL   Exported 2015-10-22  from 
REFERENCE   2  (bases 1 to 5308)
  TITLE     Direct Submission
  JOURNAL   Exported Thursday, September 1, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..5308
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        61..364
                     /note="CMV enhancer"
                     /note="CMV enhancer;human cytomegalovirus immediate early 
     promoter        365..568
                     /note="CMV promoter"
                     /note="CMV promoter;human cytomegalovirus (CMV) immediate 
                     early promoter"
     misc_feature    609..665
                     /note="MCS;multiple cloning site"
     misc_feature    667..1253
                     /note="IRES2;internal ribosome entry site (IRES) of the 
                     encephalomyocarditis virus (EMCV)"
     CDS             1254..1973
                     /product="enhanced GFP"
                     /note="enhanced GFP"
                     /note="EGFP;mammalian codon-optimized"
     polyA_signal    2096..2217
                     /note="SV40 poly(A) signal"
                     /note="SV40 poly(A) signal;SV40 polyadenylation signal"
     rep_origin      complement(2224..2679)
                     /note="f1 ori"
                     /note="f1 ori;f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        2706..2810
                     /note="bla AmpR promoter"
                     /note="AmpR promoter"
     promoter        2812..3169
                     /note="SV40 promoter"
                     /note="SV40 promoter;SV40 enhancer and early promoter"
     rep_origin      3020..3155
                     /note="SV40 ori"
                     /note="SV40 ori;SV40 origin of replication"
     CDS             3204..3998
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="aph(3')-II (or nptII)"
                     /note="NeoR/KanR;confers resistance to neomycin, kanamycin,
                     and G418 (Geneticin(R))"
     polyA_signal    4230..4277
                     /note="HSV TK poly(A) signal"
                     /note="HSV TK poly(A) signal;herpesvirus thymidine kinase 
                     polyadenylation signal"
     rep_origin      4606..5194
                     /note="ori;high-copy-number ColE1/pMB1/pBR322/pUC origin of
        1 tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg
       61 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt
      121 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca
      181 atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc
      241 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta
      301 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac
      361 catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg
      421 atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg
      481 ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt
      541 acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta
      601 ccggactcag atctcgagct caagcttcga attctgcagt cgacggtacc gcgggcccgg
      661 gatccgcccc tctccctccc ccccccctaa cgttactggc cgaagccgct tggaataagg
      721 ccggtgtgcg tttgtctata tgttattttc caccatattg ccgtcttttg gcaatgtgag
      781 ggcccggaaa cctggccctg tcttcttgac gagcattcct aggggtcttt cccctctcgc
      841 caaaggaatg caaggtctgt tgaatgtcgt gaaggaagca gttcctctgg aagcttcttg
      901 aagacaaaca acgtctgtag cgaccctttg caggcagcgg aaccccccac ctggcgacag
      961 gtgcctctgc ggccaaaagc cacgtgtata agatacacct gcaaaggcgg cacaacccca
     1021 gtgccacgtt gtgagttgga tagttgtgga aagagtcaaa tggctctcct caagcgtatt
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
