
  • Model: PVT1228
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT1228  2ug


pIRES2-EGFP Informaiton

Promoter: CMV

Replicon: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid classification: mammalian cells, fluorescent protein reporter vectors

Plasmid size: 5308bp

Prokaryotic resistance: Kan

Selection marker: Neo

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: lactation cells

Induction mode: no need to induce, transient expression.


3'sequencing primers: pEGFP-N-3:CGTCGCCGTCCAGCTCGACCAG


pIRES2-EGFP Sequence

pIRES2-EGFP contains the internal ribosome entry site (IRES; 1, 2) of the encephalomyocarditis virus (ECMV) between the MCS and the enhanced green fluorescent protein (EGFP) coding region.This permits both the gene of interest (cloned into the MCS) and the EGFP gene to be translated from a single bicistronic mRNA. pIRES2-EGFP is designed for the efficient selection (by flow cytometry or other methods) of transiently transfected mammalian cells expressing EGFP and the protein of interest. This vector can also be used to express EGFP alone or to obtain stably transfected cell lines without time-consuming drug and clonal selection.


pIRES2-EGFP Multiple cloning site





pIRES2-EGFP Sequence

LOCUS       Exported                5308 bp ds-DNA     circular SYN 31-AUG-2016

DEFINITION  synthetic circular DNA


SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 5308)

  AUTHORS   admin

  TITLE     Direct Submission

  JOURNAL   Exported 2015-10-22 

REFERENCE   2  (bases 1 to 5308)


  TITLE     Direct Submission

FEATURES             Location/Qualifiers

     source          1..5308

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     enhancer        61..364

                     /note="CMV enhancer"

                     /note="CMV enhancer;human cytomegalovirus immediate early 


     promoter        365..568

                     /note="CMV promoter"

                     /note="CMV promoter;human cytomegalovirus (CMV) immediate 

                     early promoter"

     misc_feature    609..665


                     /note="MCS;multiple cloning site"

     misc_feature    667..1253


                     /note="IRES2;internal ribosome entry site (IRES) of the 

                     encephalomyocarditis virus (EMCV)"

     CDS             1254..1973


                     /product="enhanced GFP"

                     /note="enhanced GFP"

                     /note="EGFP;mammalian codon-optimized"






     polyA_signal    2096..2217

                     /note="SV40 poly(A) signal"

                     /note="SV40 poly(A) signal;SV40 polyadenylation signal"

     rep_origin      complement(2224..2679)


                     /note="f1 ori"

                     /note="f1 ori;f1 bacteriophage origin of replication; arrow

                     indicates direction of (+) strand synthesis"

     promoter        2706..2810


                     /note="bla AmpR promoter"

                     /note="AmpR promoter"

     promoter        2812..3169

                     /note="SV40 promoter"

                     /note="SV40 promoter;SV40 enhancer and early promoter"

     rep_origin      3020..3155

                     /note="SV40 ori"

                     /note="SV40 ori;SV40 origin of replication"

     CDS             3204..3998


                     /gene="aph(3')-II (or nptII)"

                     /product="aminoglycoside phosphotransferase from Tn5"

                     /note="aph(3')-II (or nptII)"

                     /note="NeoR/KanR;confers resistance to neomycin, kanamycin,

                     and G418 (Geneticin(R))"






     polyA_signal    4230..4277

                     /note="HSV TK poly(A) signal"

                     /note="HSV TK poly(A) signal;herpesvirus thymidine kinase 

                     polyadenylation signal"

     rep_origin      4606..5194



                     /note="ori;high-copy-number ColE1/pMB1/pBR322/pUC origin of



        1 tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg

       61 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt

      121 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca

      181 atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc

      241 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta

      301 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac

      361 catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg

      421 atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg

      481 ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt

      541 acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta

      601 ccggactcag atctcgagct caagcttcga attctgcagt cgacggtacc gcgggcccgg

      661 gatccgcccc tctccctccc ccccccctaa cgttactggc cgaagccgct tggaataagg

      721 ccggtgtgcg tttgtctata tgttattttc caccatattg ccgtcttttg gcaatgtgag

      781 ggcccggaaa cctggccctg tcttcttgac gagcattcct aggggtcttt cccctctcgc

      841 caaaggaatg caaggtctgt tgaatgtcgt gaaggaagca gttcctctgg aagcttcttg

      901 aagacaaaca acgtctgtag cgaccctttg caggcagcgg aaccccccac ctggcgacag

      961 gtgcctctgc ggccaaaagc cacgtgtata agatacacct gcaaaggcgg cacaacccca

     1021 gtgccacgtt gtgagttgga tagttgtgga aagagtcaaa tggctctcct caagcgtatt

     1081 caacaagggg ctgaaggatg cccagaaggt accccattgt atgggatctg atctggggcc

     1141 tcggtgcaca tgctttacat gtgtttagtc gaggttaaaa aaacgtctag gccccccgaa

     1201 ccacggggac gtggttttcc tttgaaaaac acgatgataa tatggccaca accatggtga

     1261 gcaagggcga ggagctgttc accggggtgg tgcccatcct ggtcgagctg gacggcgacg

     1321 taaacggcca caagttcagc gtgtccggcg agggcgaggg cgatgccacc tacggcaagc

     1381 tgaccctgaa gttcatctgc accaccggca agctgcccgt gccctggccc accctcgtga

     1441 ccaccctgac ctacggcgtg cagtgcttca gccgctaccc cgaccacatg aagcagcacg

     1501 acttcttcaa gtccgccatg cccgaaggct acgtccagga gcgcaccatc ttcttcaagg

     1561 acgacggcaa ctacaagacc cgcgccgagg tgaagttcga gggcgacacc ctggtgaacc

     1621 gcatcgagct gaagggcatc gacttcaagg aggacggcaa catcctgggg cacaagctgg

     1681 agtacaacta caacagccac aacgtctata tcatggccga caagcagaag aacggcatca

     1741 aggtgaactt caagatccgc cacaacatcg aggacggcag cgtgcagctc gccgaccact

     1801 accagcagaa cacccccatc ggcgacggcc ccgtgctgct gcccgacaac cactacctga

     1861 gcacccagtc cgccctgagc aaagacccca acgagaagcg cgatcacatg gtcctgctgg

     1921 agttcgtgac cgccgccggg atcactctcg gcatggacga gctgtacaag taaagcggcc

     1981 gcgactctag atcataatca gccataccac atttgtagag gttttacttg ctttaaaaaa

     2041 cctcccacac ctccccctga acctgaaaca taaaatgaat gcaattgttg ttgttaactt

     2101 gtttattgca gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa

     2161 agcatttttt tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatcttaagg

     2221 cgtaaattgt aagcgttaat attttgttaa aattcgcgtt aaatttttgt taaatcagct

     2281 cattttttaa ccaataggcc gaaatcggca aaatccctta taaatcaaaa gaatagaccg

     2341 agatagggtt gagtgttgtt ccagtttgga acaagagtcc actattaaag aacgtggact

     2401 ccaacgtcaa agggcgaaaa accgtctatc agggcgatgg cccactacgt gaaccatcac

     2461 cctaatcaag ttttttgggg tcgaggtgcc gtaaagcact aaatcggaac cctaaaggga

     2521 gcccccgatt tagagcttga cggggaaagc cggcgaacgt ggcgagaaag gaagggaaga

     2581 aagcgaaagg agcgggcgct agggcgctgg caagtgtagc ggtcacgctg cgcgtaacca

     2641 ccacacccgc cgcgcttaat gcgccgctac agggcgcgtc aggtggcact tttcggggaa

     2701 atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca

     2761 tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt cctgaggcgg

     2821 aaagaaccag ctgtggaatg tgtgtcagtt agggtgtgga aagtccccag gctccccagc

     2881 aggcagaagt atgcaaagca tgcatctcaa ttagtcagca accaggtgtg gaaagtcccc

     2941 aggctcccca gcaggcagaa gtatgcaaag catgcatctc aattagtcag caaccatagt

     3001 cccgccccta actccgccca tcccgcccct aactccgccc agttccgccc attctccgcc

     3061 ccatggctga ctaatttttt ttatttatgc agaggccgag gccgcctcgg cctctgagct

     3121 attccagaag tagtgaggag gcttttttgg aggcctaggc ttttgcaaag atcgatcaag

     3181 agacaggatg aggatcgttt cgcatgattg aacaagatgg attgcacgca ggttctccgg

     3241 ccgcttgggt ggagaggcta ttcggctatg actgggcaca acagacaatc ggctgctctg

     3301 atgccgccgt gttccggctg tcagcgcagg ggcgcccggt tctttttgtc aagaccgacc

     3361 tgtccggtgc cctgaatgaa ctgcaagacg aggcagcgcg gctatcgtgg ctggccacga

     3421 cgggcgttcc ttgcgcagct gtgctcgacg ttgtcactga agcgggaagg gactggctgc

     3481 tattgggcga agtgccgggg caggatctcc tgtcatctca ccttgctcct gccgagaaag

     3541 tatccatcat ggctgatgca atgcggcggc tgcatacgct tgatccggct acctgcccat

     3601 tcgaccacca agcgaaacat cgcatcgagc gagcacgtac tcggatggaa gccggtcttg

     3661 tcgatcagga tgatctggac gaagagcatc aggggctcgc gccagccgaa ctgttcgcca

     3721 ggctcaaggc gagcatgccc gacggcgagg atctcgtcgt gacccatggc gatgcctgct

     3781 tgccgaatat catggtggaa aatggccgct tttctggatt catcgactgt ggccggctgg

     3841 gtgtggcgga ccgctatcag gacatagcgt tggctacccg tgatattgct gaagagcttg

     3901 gcggcgaatg ggctgaccgc ttcctcgtgc tttacggtat cgccgctccc gattcgcagc

     3961 gcatcgcctt ctatcgcctt cttgacgagt tcttctgagc gggactctgg ggttcgaaat

     4021 gaccgaccaa gcgacgccca acctgccatc acgagatttc gattccaccg ccgccttcta

     4081 tgaaaggttg ggcttcggaa tcgttttccg ggacgccggc tggatgatcc tccagcgcgg

     4141 ggatctcatg ctggagttct tcgcccaccc tagggggagg ctaactgaaa cacggaagga

     4201 gacaataccg gaaggaaccc gcgctatgac ggcaataaaa agacagaata aaacgcacgg

     4261 tgttgggtcg tttgttcata aacgcggggt tcggtcccag ggctggcact ctgtcgatac

     4321 cccaccgaga ccccattggg gccaatacgc ccgcgtttct tccttttccc caccccaccc

     4381 cccaagttcg ggtgaaggcc cagggctcgc agccaacgtc ggggcggcag gccctgccat

     4441 agcctcaggt tactcatata tactttagat tgatttaaaa cttcattttt aatttaaaag

     4501 gatctaggtg aagatccttt ttgataatct catgaccaaa atcccttaac gtgagttttc

     4561 gttccactga gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag atcctttttt

     4621 tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg tggtttgttt

     4681 gccggatcaa gagctaccaa ctctttttcc gaaggtaact ggcttcagca gagcgcagat

     4741 accaaatact gtccttctag tgtagccgta gttaggccac cacttcaaga actctgtagc

     4801 accgcctaca tacctcgctc tgctaatcct gttaccagtg gctgctgcca gtggcgataa

     4861 gtcgtgtctt accgggttgg actcaagacg atagttaccg gataaggcgc agcggtcggg

     4921 ctgaacgggg ggttcgtgca cacagcccag cttggagcga acgacctaca ccgaactgag

     4981 atacctacag cgtgagctat gagaaagcgc cacgcttccc gaagggagaa aggcggacag

     5041 gtatccggta agcggcaggg tcggaacagg agagcgcacg agggagcttc cagggggaaa

     5101 cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc gtcgattttt

     5161 gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc agcaacgcgg cctttttacg

     5221 gttcctggcc ttttgctggc cttttgctca catgttcttt cctgcgttat cccctgattc

     5281 tgtggataac cgtattaccg ccatgcat



Product is for research use only!

Search name

pIRES2-EGFP,Plasmid pIRES2-EGFP,pIRES2-EGFP vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
