

  • Model: PVT10719
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT10719  2ug 


pIRESneo3  Information

Promoter: CMV

Replicon: pUC

Terminator: SV40 poly (a) signal

Plasmid classification: mammalian cells, protein overexpression vector

Plasmid size: 5.2kb

Prokaryotic resistance: Amp

Eukaryotic resistance: G418

Clone strain: DH5a

Culture conditions: 37℃

Expression host: Mammalian cells

Induction mode: transient expression without induction

5 'sequencing primer: cmv-f: cgcaaaatgggcgtgtgtgggtgggtg

3 'sequencing primers: primers were designed according to the sequence

Plasmid host: Mammalian cells

Purpose of plasmid: protein expression

Fragment type: ORF

Fragment species: empty bodies

Prokaryotic resistance: Amp

Eukaryotic resistance: G418

Fluorescent labeling:


pIRESneo3 Description

pIRESneo3 contains the internal ribosome entry site (IRES) of the encephalomyocarditis virus (ECMV), which permits the translation of two open reading frames from one messenger RNA (1–3). After selection with G418, nearly all surviving colonies will stably express the gene of interest, thus decreasing the need to screen large numbers of colonies to find functional clones. To select for cells that express high levels of the gene of interest, the selective pressure for antibiotic resistance was increased by shifting the neomycin phosphotransferase gene downstream to a less optimal position for translation as directed by the IRES sequence (1). By decreasing the level of expression of the antibiotic resistance marker, the selective pressure on the entire expression cassette is increased, resulting in the selection of cells that express the entire transcript, including the gene of interest, at high levels.


pIRESneo3 Multiple cloning site



pIRESneo3 Sequence

LOCUS       Exported                5260 bp ds-DNA     circular SYN 29-AUG-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled 10

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 5260)


  TITLE     Direct Submission

  JOURNAL   Exported Monday, August 29, 2016 from SnapGene Viewer 3.1.4

FEATURES             Location/Qualifiers

     source          1..5260

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     enhancer        235..614

                     /note="CMV enhancer"

                     /note="human cytomegalovirus immediate early enhancer"

     promoter        615..818

                     /note="CMV promoter"

                     /note="human cytomegalovirus (CMV) immediate early 


     promoter        863..881

                     /note="T7 promoter"

                     /note="promoter for bacteriophage T7 RNA polymerase"

     intron          1051..1280

                     /note="chimeric intron"

                     /note="chimera between introns from adenovirus and 

                     immunoglobulin heavy chain genes"

     misc_feature    1338..1911


                     /note="internal ribosome entry site (IRES) of the 

                     encephalomyocarditis virus (EMCV)"

     CDS             1947..2750


                     /gene="aph(3')-II (or nptII)"

                     /product="aminoglycoside phosphotransferase from Tn5"


                     /note="confers resistance to neomycin, kanamycin, and G418 







     polyA_signal    2880..3001

                     /note="SV40 poly(A) signal"

                     /note="SV40 polyadenylation signal"

     primer_bind     complement(3103..3119)

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     protein_bind    3127..3143

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     promoter        complement(3151..3181)

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    3196..3217

                     /bound_moiety="E. coli catabolite activator protein"

                     /note="CAP binding site"

                     /note="CAP binding activates transcription in the presence 

                     of cAMP."

     rep_origin      complement(3505..4093)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(4264..5124)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     promoter        complement(5125..5229)


                     /note="AmpR promoter"


        1 gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg

       61 ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg

      121 cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc

      181 ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt

      241 gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata

      301 tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc

      361 cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc

      421 attgacgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt

      481 atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt

      541 atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca

      601 tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg

      661 actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc

      721 aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg

      781 gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca

      841 ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gcttggtacc

      901 gagctcggat cgatatctgc ggcctagcta gcgcttaagg cctgttaacc ggtcgtacgt

      961 ctccggattc gaattcggat ccgcggccgc atagataact gatccagtgt gctggaatta

     1021 attcgctgtc tgcgagggcc agctgttggg gtgagtactc cctctcaaaa gcgggcatga

     1081 cttctgcgct aagattgtca gtttccaaaa acgaggagga tttgatattc acctggcccg

     1141 cggtgatgcc tttgagggtg gccgcgtcca tctggtcaga aaagacaatc tttttgttgt

     1201 caagcttgag gtgtggcagg cttgagatct ggccatacac ttgagtgaca atgacatcca

     1261 ctttgccttt ctctccacag gtgtccactc ccaggtccaa ctgcaggtcg agcatgcatc

     1321 tagggcggcc aattccgccc ctctccctcc ccccccccta acgttactgg ccgaagccgc

     1381 ttggaataag gccggtgtgc gtttgtctat atgttatttt ccaccatatt gccgtctttt

     1441 ggcaatgtga gggcccggaa acctggccct gtcttcttga cgagcattcc taggggtctt

     1501 tcccctctcg ccaaaggaat gcaaggtctg ttgaatgtcg tgaaggaagc agttcctctg

     1561 gaagcttctt gaagacaaac aacgtctgta gcgacccttt gcaggcagcg gaacccccca

     1621 cctggcgaca ggtgcctctg cggccaaaag ccacgtgtat aagatacacc tgcaaaggcg

     1681 gcacaacccc agtgccacgt tgtgagttgg atagttgtgg aaagagtcaa atggctctcc

     1741 tcaagcgtat tcaacaaggg gctgaaggat gcccagaagg taccccattg tatgggatct

     1801 gatctggggc ctcggtgcac atgctttaca tgtgtttagt cgaggttaaa aaaacgtcta

     1861 ggccccccga accacgggga cgtggttttc ctttgaaaaa cacgatgata agcttgccac

     1921 aacccgggat aattcctgca gccaatatgg gatcggccat tgaacaagat ggattgcacg

     1981 caggttctcc ggccgcttgg gtggagaggc tattcggcta tgactgggca caacagacaa

     2041 tcggctgctc tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg gttctttttg

     2101 tcaagaccga cctgtccggt gccctgaatg aactgcagga cgaggcagcg cggctatcgt

     2161 ggctggccac gacgggcgtt ccttgcgcag ctgtgctcga cgttgtcact gaagcgggaa

     2221 gggactggct gctattgggc gaagtgccgg ggcaggatct cctgtcatct caccttgctc

     2281 ctgccgagaa agtatccatc atggctgatg caatgcggcg gctgcatacg cttgatccgg

     2341 ctacctgccc attcgaccac caagcgaaac atcgcatcga gcgagcacgt actcggatgg

     2401 aagccggtct tgtcgatcag gatgatctgg acgaagagca tcaggggctc gcgccagccg

     2461 aactgttcgc caggctcaag gcgcgcatgc ccgacggcga tgatctcgtc gtgacccatg

     2521 gcgatgcctg cttgccgaat atcatggtgg aaaatggccg cttttctgga ttcatcgact

     2581 gtggccggct gggtgtggcg gaccgctatc aggacatagc gttggctacc cgtgatattg

     2641 ctgaagagct tggcggcgaa tgggctgacc gcttcctcgt gctttacggt atcgccgctc

     2701 ccgattcgca gcgcatcgcc ttctatcgcc ttcttgacga gttcttctga ggggatcaat

     2761 tctctagata actgatcata atcagccata ccacatttgt agaggtttta cttgctttaa

     2821 aaaacctccc acacctcccc ctgaacctga aacataaaat gaatgcaatt gttgttgtta

     2881 acttgtttat tgcagcttat aatggttaca aataaagcaa tagcatcaca aatttcacaa

     2941 ataaagcatt tttttcactg cattctagtt gtggtttgtc caaactcatc aatgtatctt

     3001 aacgcgtcga gtgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt

     3061 ctgtataccg tcgacctcta gctagagctt ggcgtaatca tggtcatagc tgtttcctgt

     3121 gtgaaattgt tatccgctca caattccaca caacatacga gccggaagca taaagtgtaa

     3181 agcctggggt gcctaatgag tgagctaact cacattaatt gcgttgcgct cactgcccgc

     3241 tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac gcgcggggag

     3301 aggcggtttg cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt

     3361 cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga

     3421 atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg

     3481 taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa

     3541 aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt

     3601 tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct

     3661 gtccgccttt ctcccttcgg gaagcgtggc gctttctcaa tgctcacgct gtaggtatct

     3721 cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc

     3781 cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt

     3841 atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc

     3901 tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat

     3961 ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa

     4021 acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa

     4081 aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga

     4141 aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct

     4201 tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga

     4261 cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc

     4321 catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg

     4381 ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat

     4441 aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat

     4501 ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg

     4561 caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc

     4621 attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa

     4681 agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc

     4741 actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt

     4801 ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag

     4861 ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt

     4921 gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag

     4981 atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac

     5041 cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc

     5101 gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca

     5161 gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg

     5221 ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc


No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
