

  • Model: PVT11390
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT11390
Packing 2ug


pJB866 Informaiton

Promoter: Pm promoter

Replicon: RK2 oriV

Terminator: Termnator

Plasmid classification: other host plasmids; other plasmids; other functional plasmids.

Plasmid size: 8296bp

Prokaryotic resistance: tetracycline Tet

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression host: Gram-negative bacteria

Training conditions: please refer to the literature

5'sequencing primers: Pm-F:cggtttgatagggataagtcc

3'sequencing primers: Ter-R:ccgcattaaaatctagcgagg


pJB866 Description

PJB866 is a broad host expression vector of Gram-negative bacteria, and Pm promoter drives the expression of target genes.


pJB866 Sequence

LOCUS       Exported                8296 bp ds-DNA     circular SYN 15-SEP-2017

DEFINITION  synthetic circular DNA

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 8296)

  TITLE     Direct Submission

  JOURNAL   Exported Sep 15, 2017

FEATURES             Location/Qualifiers

     source          1..8296

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     misc_feature    5..127


     promoter        complement(133..266)

                     /label=Pm promoter

                     /note="The bacterial Pm promoter is activated by XylS in 

                     the presence of benzoate or m-toluate (Marques et al., 


     CDS             966..1931



                     /product="XylS regulator encoded by the Pseudomonas putida 

                     TOL plasmid pWWO"


                     /note="stimulates transcription from the Pm promoter in the

                     presence of aromatic compounds such as m-toluate or 








     oriT            2471..2579

                     /note="incP origin of transfer"

     CDS             complement(3036..3686)







     CDS             3717..4991











     rep_origin      5566..6096

                     /label=RK2 oriV

                     /note="incP origin of replication"

     misc_feature    6318..6436

                     /label=Neo Promoter

     CDS             6488..7636


                     /product="trans-acting replication protein that binds to 

                     and activates oriV"









     misc_feature    7687..8296



        1 gatcttcgaa tgcatcgcgc gcaccgtacg tctcgaggaa ttcctgcagg atatctggat

       61 ccacgaagct tcccatggtg acgtcaccgg ttctagatac ctaggtgagc tctggtaccg

      121 cggccgcaat tcacatgttc atgactccat tattattgtt tctgttgcat aaagcctaag

      181 gggtaggcct ttctagagat agccattttt tgcactcctg tatccgcttc ttgcaaggct

      241 ggacttatcc ctatcaaacc ggacacccgg tcgttggtca gatcaagcta attcccatgc

      301 atggtgaaaa cgggggcgaa gaagttgtcc atattggcca cgtttaaatc aaaactggtg

      361 aaactcaccc agggattggc tgagacgaaa aacatattct caataaaccc tttagggaaa

      421 taggccaggt tttcaccgta acacgccaca tcttgcgaat atatgtgtag aaactgccgg

      481 aaatcgtcgt ggtattcact ccagagcgat gaaaacgttt cagtttgctc atggaaaacg

      541 gtgtaacaag ggtgaacact atcccatatc accagctcac cgtctttcat tgccatacgt

      601 aattccggat gagcattcat caggcgggca agaatgtgaa taaaggccgg ataaaacttg

      661 tgcttatttt tctttacggt ctttaaaaag gccgtaatat ccagcagatc ccctttatcc

      721 gccaattcgt cgccgcatgc cccgacagca cgaacttctg gtgttctcgc ttcttaaaaa

      781 gaacgtcttc gttctgcttg gcgttatttt tgcttggaaa agtggtcact gattgcaaaa

      841 aggatggcgc aacgtggcaa tgggggtaac ccgtatacgc atcacgtcga gatgcatttt

      901 catcgacttg gcgcctttct acatcacacc aagcagccca cattaaaata agagaaccgt

      961 gaactatgga tttttgctta ttgaacgaga aaagtcagat cttcgtccac gccgagccct

     1021 atgcagtctc cgattatgtt aaccagtatg tcggtacgca ctctattcgc ctgcccaagg

     1081 gcgggccccc ggcaggcagg ctgcaccaca gaatcttcgg atgcctcgac ctgtgtcgaa

     1141 tcagctacgg cggtagcgtg agggtaatct cgcctggatt agagacctgt tatcatctgc

     1201 aaataatact caaaggccat tgcctgtggc gtggccatgg ccaggagcac tattttgcgc

     1261 cgggcgaact attgctgctc aatccggatg accaagccga cctgacctat tcagaagatt

     1321 gcgagaaatt tatcgttaaa ttgccctcag tggtccttga tcgggcatgc agtgacaaca

     1381 attggcacaa gccgagggag ggtatccgtt tcgccgcgcg acacaatctc cagcaactcg

     1441 atggctttat caatctactc gggttagttt gtgacgaagc ggaacataca aagtcgatgc

     1501 ctcgggtcca agagcactat gcggggatca tcgcttccaa gctgctcgaa atgctgggca

     1561 gcaatgtcag ccgtgaaatt ttcagcaaag gtaacccgtc tttcgagcga gtcgttcaat

     1621 tcattgagga gaatctcaaa cggaatatca gccttgagcg gttagcggag ctggcgatga

     1681 tgagtccacg ctcgctctac aatttgttcg agaagcatgc cggcaccacg ccgaagaact

     1741 acatccgcaa ccgcaagctc gaaagcatcc gcgcctgctt gaacgatccc agtgccaatg

     1801 tgcgtagtat aactgagata gccctagact acggcttctt acatttggga cgcttcgctg

     1861 aaaactatag gagcgcgttc ggcgagttgc cttccgacac cctgcgtcaa tgcaaaaagg

     1921 aagtggcttg attacgaacg tagccgaaga agggatgggt tggcatcgcc cggctttctt

     1981 agacactctc caagctctga aatagcgttt tacaaactcc actggctata gtgccggcgt

     2041 ttgcccgcgc tctccgtggc cgcgtcccaa tgcaggtcgg gttcctcgac ccgaagtgcc

     2101 cttgggcatc tccacttcag cgtctgacct tgctggccag ttcgccgccg atgccgaagt

     2161 ggcccttggc catctccgtg ataatcactc gcacgctggt cagcggcgca tccagggagc

     2221 gcgagatggc ctcgctgact tcccgaatga gggtttcctt ctgctcgtcg ctgcggcctt

     2281 caaggatgtg gatctgctgg ccgaaagggg gatgtgctgc aaggcgatta agttgggtaa

     2341 cgccagggtt ttcccagtca cgacgttgta aaacgacggc cagtgaatta attcttgaag

     2401 acgaaagggc ctcgtgatac gcctattttt ataggttaat gtcatgataa taatggtttc

     2461 ttagagctta cggccagcct cgcagagcag gattcccgtt gagcaccgcc aggtgcgaat

     2521 aagggacagt gaagaaggaa cacccgctcg cgggtgggcc tacttcacct atcctgcccg

     2581 gctgacgccg ttggatacac caaggaaagt ctacacgaac cctttggcaa aatcctgtat

     2641 atcgtgcgaa aaaggatgga tataccgaaa aaatcgctat aatgaccccg aagcagggtt

     2701 atgcagcgga aaagatccgt cggctgcagc gatccgtcga tctatctcat ctgcgcaagg

     2761 cagaacgtga agacggccgc cctggacctc gcccgcgagc gccagcgcac gaggccggcg

     2821 cgcggacccg ccgcggccca cgagcggacg ccgcagcagg agcgccagaa ggccgccaga

     2881 gaggccgagc gcggcgtgag gcttggacgc tagggcaggg catgaaaaag cccgtagcgg

     2941 gcgctacggg gctctgacgc ggtggaaagg gggaggggat gttgtctaca tggctctgct

     3001 gtagtgagtg ggttgcgctc cggcagcggt cctgatcaat cgtcaccctt tctcggtcct

     3061 tcaacgttcc tgacaacgag cctccttttc gccaatccat cgacaatcac cgcgagtccc

     3121 tgctcgaacg ctgcgtccgg accggcttcg tcgaaggcgt ctatcgcggc ccgcaacagc

     3181 ggcgagagcg gagcctgttc aacggtgccg ccgcgctcgc cggactcgct gtcgccggcc

     3241 tgctcctcaa gcacggcccc aacagtgaag tagctgattg tcatcagcgc attgacggcg

     3301 tccccggccg aaaaacccgc ctcgcagagg aagcgaagct gcgcgtcggc cgtttccatc

     3361 tgcggtgcgc ccggtcgcgt gccggcatgg atgcgcgcgc catcgcggta ggcgagcagc

     3421 gcctgcctga agctgcgggc attcccagtc agaaatgagc gccagtcgtc gtcggctctc

     3481 ggcaccgaag tgctatgatt ctccgccagc atggcttcgg ccagtgcgtc gagcagcgcc

     3541 cgcttgttcc tgaagtgcca gtaaagcgcc ggctgctgaa cccccaaccg ttccgccagt

     3601 ttgcgtgtcg tcagaccgtc tacgccgacc tcgttcaaca ggtctagggc ggcacggatc

     3661 actgtattcg gctgcaactt tgtcatgctt gacactttat cactgataaa cataatatgt

     3721 ccaccaactt atcagtgata aagaatccgc gcgttcaatc ggaccagcgg aggctggtcc

     3781 ggaggccaga cgtgaaaccc aacatacccc tgatcgtaat tctgagcact gtcgcgctcg

     3841 acgctgtcgg catcggcctg attatgccgg tgctgccggg cctcctgcgc gatctggttc

     3901 actcgaacga cgtcaccgcc cactatggca ttctgctggc gctgtatgcg ttggtgcaat

     3961 ttgcctgcgc acctgtgctg ggcgcgctgt cggatcgttt cgggcggcgg ccaatcttgc

     4021 tcgtctcgct ggccggcgcc actgtcgact acgccatcat ggcgacagcg cctttccttt

     4081 gggttctcta tatcgggcgg atcgtggccg gcatcaccgg ggcgactggg gcggtagccg

     4141 gcgcttatat tgccgatatc actgatggcg atgagcgcgc gcggcacttc ggcttcatga

     4201 gcgcctgttt cgggttcggg atggtcgcgg gacctgtgct cggtgggctg atgggcggtt

     4261 tctcccccca cgctccgttc ttcgccgcgg cagccttgaa cggcctcaat ttcctgacgg

     4321 gctgtttcct tttgccggag tcgcacaaag gcgaacgccg gccgttacgc cgggaggctc

     4381 tcaacccgct cagcttcgtt cggtgggccc ggggcatgac cgtcgtcgcc gccctgatgg

     4441 cggtcttctt catcatgcaa cttgtcggac aggtgccggc cgcgctttgg gtcattttcg

     4501 gcgaggatcg ctttcactgg gacgcgacca cgatcggcat ttcgcttgcc gcatttggca

     4561 ttctgcattc actcgcccag gcaatgatca ccggccctgt agccgcccgg ctcggcgaaa

     4621 ggcgggcact catgctcgga atgattgccg acggcacagg ctacatcctg cttgccttcg

     4681 cgacacgggg atggatggcg ttcccgatca tggtcctgct tgcttcgggt ggcatcggaa

     4741 tgccggcgct gcaagcaatg ttgtccaggc aggtggatga ggaacgccag gggcagctgc

     4801 aaggctcact ggcggcgctc accagcctga cctcgatcgt cggacccctc ctcttcacgg

     4861 cgatctatgc ggcttctata acaacgtgga acgggtgggc atggattgca ggcgctgccc

     4921 tctacttgct ctgcctgccg gcgctgcgtc gcgggctttg gagcggcgca gggcaacgag

     4981 ccgatcgctg atcgtggaaa cgatagggac ggatcgctgc agcgcaaact attaactggc

     5041 gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc ggataaagtt

     5101 gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga

     5161 gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg taagccctcc

     5221 cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg aaatagacag

     5281 atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca

     5341 tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc

     5401 ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca

     5461 gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg ggggatcagg

     5521 accgctgccg gagcgcaacc cactcactac agcagagcca tgtagggccg ccggcgttgt

     5581 ggataccacg cggaaaactt ggccctcact gacagatgag gggcggacgt tgacacttga

     5641 ggggccgact cacccggcgc ggcgttgaca gatgaggggc aggctcgatt tcggccggcg

     5701 acgtggagct ggccagcctc gcaaatcggc gaaaacgcct gattttacgc gagtttccca

     5761 cagatgatgt ggacaagcct ggggataagt gccctgcggt attgacactt gaggggcgcg

     5821 actactgaca gatgaggggc gcgatccttg acacttgagg ggcagagtga tgacagatga

     5881 ggggcgcacc tattgacatt tgaggggctg tccacaggca gaaaatccag catttgcaag

     5941 ggtttccgcc cgtttttcgg ccaccgctaa cctgtctttt aacctgcttt taaaccaata

     6001 tttataaacc ttgtttttaa ccagggctgc gccctggcgc gtgaccgcgc acgccgaagg

     6061 ggggtgcccc cccttctcga accctcccgg cccgctaacg cggcacccca tccccccagg

     6121 ggctgcgccc ctcggccgcg aacgacctca ccccaaaaat ggcagccacg tagaaagcca

     6181 gtccgcagaa acggtgctga ccccggatga atgtcagcta ctgggctatc tggacaaggg

     6241 aaaacgcaag cgcaaagaga aagcaggtag cttgcagtgg gcttacatgg cgatagctag

     6301 actgggcggt tttatggaca gcaagcgaac cggaattgcc agctggggcg ccctctggta

     6361 aggttgggaa gccctgcaaa gtaaactgga tggctttctt gccgccaagg atctgatggc

     6421 gcaggggatc aagatcgacg gatcgatccg gggaattaat tccggggcaa tcccgcaagg

     6481 agggtgaatg aatcggacgt ttgaccggaa ggcatacagg caagaactga tcgacgcggg

     6541 gttttccgcc gaggatgccg aaaccatcgc aagccgcacc gtcatgcgtg cgccccgcga

     6601 aaccttccag tccgtcggct cgatggtcca gcaagctacg gccaagatcg agcgcgacag

     6661 cgtgcaactg gctccccctg ccctgcccgc gccatcggcc gccgtggagc gttcgcgtcg

     6721 tctcgaacag gaggcggcag gtttggcgaa gtcgatgacc atcgacacgc gaggaactat

     6781 gacgaccaag aagcgaaaaa ccgccggcga ggacctggca aaacaggtca gcgaggccaa

     6841 gcaggccgcg ttgctgaaac acacgaagca gcagatcaag gaaatgcagc tttccttgtt

     6901 cgatattgcg ccgtggccgg acacgatgcg agcgatgcca aacgacacgg cccgctctgc

     6961 cctgttcacc acgcgcaaca agaaaatccc gcgcgaggcg ctgcaaaaca aggtcatttt

     7021 ccacgtcaac aaggacgtga agatcaccta caccggcgtc gagctgcggg ccgacgatga

     7081 cgaactggtg tggcagcagg tgttggagta cgcgaagcgc acccctatcg gcgagccgat

     7141 caccttcacg ttctacgagc tttgccagga cctgggctgg tcgatcaatg gccggtatta

     7201 cacgaaggcc gaggaatgcc tgtcgcgcct acaggcgacg gcgatgggct tcacgtccga

     7261 ccgcgttggg cacctggaat cggtgtcgct gctgcaccgc ttccgcgtcc tggaccgtgg

     7321 caagaaaacg tcccgttgcc aggtcctgat cgacgaggaa atcgtcgtgc tgtttgctgg

     7381 cgaccactac acgaaattca tatgggagaa gtaccgcaag ctgtcgccga cggcccgacg

     7441 gatgttcgac tatttcagct cgcaccggga gccgtacccg ctcaagctgg aaaccttccg

     7501 cctcatgtgc ggatcggatt ccacccgcgt gaagaagtgg cgcgagcagg tcggcgaagc

     7561 ctgcgaagag ttgcgaggca gcggcctggt ggaacacgcc tgggtcaatg atgacctggt

     7621 gcattgcaaa cgctagggcc ttgtggggtc agttccggct gggggttcag cagccacctg

     7681 catcgcaagc tagcttgcta gagggtcagc tttatgcttg taaaccgttt tgtgaaaaaa

     7741 tttttaaaat aaaaaagggg acctctaggg tccccaatta attagtaata taatctatta

     7801 aaggtcattc aaaaggtcat ccaccggatc aattcccctg ctcgcgcagg ctgggtgcca

     7861 agctctcggg taacatcaag gcccgatcct tggtagtcgg caaataatgt ctaacaattc

     7921 gttcaagccg acgccgcttc gcggcgcggc ttaactcaag cgttagatgc actaagcaca

     7981 taattgctca cagccaaact atcaggtcaa gtctgctttt attattttta agcgtgcata

     8041 ataagcccta cacaaattgg gagatatatc atgaaaggct ggctttttct tgttatcgca

     8101 atagttggcg aagtaatcgc aacatccgca ttaaaatcta gcgagggctt tactaagctg

     8161 atccggtgga tgaccttttg aatgaccttt aatagattat attactaatt aattggggac

     8221 cctagaggtc ccctttttta ttttaaaaat tttttcacaa aacggtttac aagcataaag

     8281 ctgactctag ctagag


Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
