

  • Model: PVT11390
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT11390
Packing 2ug


pJB866 Informaiton

Promoter: Pm promoter

Replicon: RK2 oriV

Terminator: Termnator

Plasmid classification: other host plasmids; other plasmids; other functional plasmids.

Plasmid size: 8296bp

Prokaryotic resistance: tetracycline Tet

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression host: Gram-negative bacteria

Training conditions: please refer to the literature

5'sequencing primers: Pm-F:cggtttgatagggataagtcc

3'sequencing primers: Ter-R:ccgcattaaaatctagcgagg


pJB866 Description

PJB866 is a broad host expression vector of Gram-negative bacteria, and Pm promoter drives the expression of target genes.


pJB866 Sequence

LOCUS       Exported                8296 bp ds-DNA     circular SYN 15-SEP-2017
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 8296)
  TITLE     Direct Submission
  JOURNAL   Exported Sep 15, 2017  
FEATURES             Location/Qualifiers
     source          1..8296
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     misc_feature    5..127
     promoter        complement(133..266)
                     /label=Pm promoter
                     /note="The bacterial Pm promoter is activated by XylS in 
                     the presence of benzoate or m-toluate (Marques et al., 
     CDS             966..1931
                     /product="XylS regulator encoded by the Pseudomonas putida 
                     TOL plasmid pWWO"
                     /note="stimulates transcription from the Pm promoter in the
                     presence of aromatic compounds such as m-toluate or 
     oriT            2471..2579
                     /note="incP origin of transfer"
     CDS             complement(3036..3686)
     CDS             3717..4991
     rep_origin      5566..6096
                     /label=RK2 oriV
                     /note="incP origin of replication"
     misc_feature    6318..6436
                     /label=Neo Promoter
     CDS             6488..7636
                     /product="trans-acting replication protein that binds to 
                     and activates oriV"
     misc_feature    7687..8296
        1 gatcttcgaa tgcatcgcgc gcaccgtacg tctcgaggaa ttcctgcagg atatctggat
       61 ccacgaagct tcccatggtg acgtcaccgg ttctagatac ctaggtgagc tctggtaccg
      121 cggccgcaat tcacatgttc atgactccat tattattgtt tctgttgcat aaagcctaag
      181 gggtaggcct ttctagagat agccattttt tgcactcctg tatccgcttc ttgcaaggct
      241 ggacttatcc ctatcaaacc ggacacccgg tcgttggtca gatcaagcta attcccatgc
      301 atggtgaaaa cgggggcgaa gaagttgtcc atattggcca cgtttaaatc aaaactggtg
      361 aaactcaccc agggattggc tgagacgaaa aacatattct caataaaccc tttagggaaa
      421 taggccaggt tttcaccgta acacgccaca tcttgcgaat atatgtgtag aaactgccgg
      481 aaatcgtcgt ggtattcact ccagagcgat gaaaacgttt cagtttgctc atggaaaacg
      541 gtgtaacaag ggtgaacact atcccatatc accagctcac cgtctttcat tgccatacgt
      601 aattccggat gagcattcat caggcgggca agaatgtgaa taaaggccgg ataaaacttg
      661 tgcttatttt tctttacggt ctttaaaaag gccgtaatat ccagcagatc ccctttatcc
      721 gccaattcgt cgccgcatgc cccgacagca cgaacttctg gtgttctcgc ttcttaaaaa
      781 gaacgtcttc gttctgcttg gcgttatttt tgcttggaaa agtggtcact gattgcaaaa
      841 aggatggcgc aacgtggcaa tgggggtaac ccgtatacgc atcacgtcga gatgcatttt
      901 catcgacttg gcgcctttct acatcacacc aagcagccca cattaaaata agagaaccgt
      961 gaactatgga tttttgctta ttgaacgaga aaagtcagat cttcgtccac gccgagccct
     1021 atgcagtctc cgattatgtt aaccagtatg tcggtacgca ctctattcgc ctgcccaagg
     1081 gcgggccccc ggcaggcagg ctgcaccaca gaatcttcgg atgcctcgac ctgtgtcgaa
     1141 tcagctacgg cggtagcgtg agggtaatct cgcctggatt agagacctgt tatcatctgc
     1201 aaataatact caaaggccat tgcctgtggc gtggccatgg ccaggagcac tattttgcgc
     1261 cgggcgaact attgctgctc aatccggatg accaagccga cctgacctat tcagaagatt
     1321 gcgagaaatt tatcgttaaa ttgccctcag tggtccttga tcgggcatgc agtgacaaca
     1381 attggcacaa gccgagggag ggtatccgtt tcgccgcgcg acacaatctc cagcaactcg
     1441 atggctttat caatctactc gggttagttt gtgacgaagc ggaacataca aagtcgatgc
     1501 ctcgggtcca agagcactat gcggggatca tcgcttccaa gctgctcgaa atgctgggca
     1561 gcaatgtcag ccgtgaaatt ttcagcaaag gtaacccgtc tttcgagcga gtcgttcaat
     1621 tcattgagga gaatctcaaa cggaatatca gccttgagcg gttagcggag ctggcgatga
     1681 tgagtccacg ctcgctctac aatttgttcg agaagcatgc cggcaccacg ccgaagaact
     1741 acatccgcaa ccgcaagctc gaaagcatcc gcgcctgctt gaacgatccc agtgccaatg
     1801 tgcgtagtat aactgagata gccctagact acggcttctt acatttggga cgcttcgctg
     1861 aaaactatag gagcgcgttc ggcgagttgc cttccgacac cctgcgtcaa tgcaaaaagg
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
