pK7GWIWG2II- RedRoot


  • Model: PVT11160
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT11160
Packing 2ug


pK7GWIWG2II-RedRoot Information

Function plant expression plasmid

Promoter: CaMV 35S

Replicon: pVS1 oriV, ori

Terminator: NOS

Plasmid classification: plant series, gateway vector

Plasmid size: 15413bp

Plasmid tagging: ccdB

Prokaryotic resistance: Kan

Selection marker: Neo

Clone strain: DB3.1

Culture conditions: 37 C, aerobic LB

Expression host: plant cells

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

Primers for 3'sequencing: primers designed based on sequences


pK7GWIWG2II-RedRoot Multiple cloing site



pK7GWIWG2II-RedRoot Sequence

LOCUS       Exported               15413 bp ds-DNA     circular SYN 20-JUL-2016

DEFINITION  synthetic circular DNA




SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 15413)


  TITLE     Direct Submission

  JOURNAL   Exported Monday, September 19, 2016 from SnapGene Viewer 3.2.1

FEATURES             Location/Qualifiers

     source          1..15413

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     terminator      65..317

                     /note="NOS terminator"

                     /note="nopaline synthase terminator and poly(A) signal"

     protein_bind    2772..2896

                     /gene="mutant version of attR"

                     /bound_moiety="LR Clonase(TM)"


                     /note="recombination site for the Gateway(R) LR reaction"

     promoter        2921..2951

                     /note="lac UV5 promoter"

                     /note="E. coli lac promoter with an ""up"" mutation"

     CDS             3303..3608



                     /product="CcdB, a bacterial toxin that poisons DNA gyrase"


                     /note="Plasmids containing the ccdB gene cannot be 

                     propagated in standard E. coli strains."



     protein_bind    complement(3649..3773)

                     /gene="mutant version of attR"

                     /bound_moiety="LR Clonase(TM)"


                     /note="recombination site for the Gateway(R) LR reaction"

     CDS             4148..4807



                     /product="chloramphenicol acetyltransferase"


                     /note="confers resistance to chloramphenicol"





     protein_bind    5210..5334

                     /gene="mutant version of attR"

                     /bound_moiety="LR Clonase(TM)"


                     /note="recombination site for the Gateway(R) LR reaction"

     CDS             complement(5375..5680)



                     /product="CcdB, a bacterial toxin that poisons DNA gyrase"


                     /note="Plasmids containing the ccdB gene cannot be 

                     propagated in standard E. coli strains."



     promoter        complement(6032..6062)

                     /note="lac UV5 promoter"

                     /note="E. coli lac promoter with an ""up"" mutation"

     protein_bind    complement(6087..6211)

                     /gene="mutant version of attR"

                     /bound_moiety="LR Clonase(TM)"


                     /note="recombination site for the Gateway(R) LR reaction"

     promoter        complement(6320..6664)

                     /note="CaMV 35S promoter"

                     /note="strong constitutive promoter from cauliflower mosaic


     misc_feature    7357..7381

                     /note="RB T-DNA repeat"

                     /note="right border repeat from nopaline C58 T-DNA"

     CDS             8681..9310


                     /product="stability protein from the Pseudomonas plasmid 

                     pVS1 (Heeb et al., 2000)"

                     /note="pVS1 StaA"





     CDS             9744..10811


                     /product="replication protein from the Pseudomonas plasmid 

                     pVS1 (Heeb et al., 2000)"

                     /note="pVS1 RepA"








     rep_origin      10877..11071

                     /note="pVS1 oriV"

                     /note="origin of replication for the Pseudomonas plasmid 

                     pVS1 (Heeb et al., 2000)"

     misc_feature    11415..11555


                     /note="basis of mobility region from pBR322"

     rep_origin      complement(11741..12329)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(12573..13364)



                     /product="aminoglycoside adenylyltransferase (Murphy, 



                     /note="confers resistance to spectinomycin and 







     misc_feature    13892..13916

                     /note="LB T-DNA repeat"

                     /note="left border repeat from nopaline C58 T-DNA"

     terminator      14009..14261

                     /note="NOS terminator"

                     /note="nopaline synthase terminator and poly(A) signal"

     CDS             complement(14301..15095)


                     /gene="aph(3')-II (or nptII)"

                     /product="aminoglycoside phosphotransferase from Tn5"


                     /note="confers resistance to neomycin, kanamycin, and G418 







     promoter        complement(15129..15308)

                     /note="NOS promoter"

                     /note="nopaline synthase promoter"


        1 ctagatgcat gctcgagcgg ccgccagtgt gatggatatc tgcagaattc gcccttgggc

       61 ccccgatcta gtaacataga tgacaccgcg cgcgataatt tatcctagtt tgcgcgctat

      121 attttgtttt ctatcgcgta ttaaatgtat aattgcggga ctctaatcat aaaaacccat

      181 ctcataaata acgtcatgca ttacatgtta attattacat gcttaacgta attcaacaga

      241 aattatatga taatcatcgc aagaccggca acaggattca atcttaagaa actttattgc

      301 caaatgtttg aacgatcggg aattggatcc tacaggaaca ggtggtggcg gccctcggtg

      361 cgctcgtact gctccacgat ggtgtagtcc tcgtttgtgg gaggtgatgt ccagcttgga

      421 gtccacgtag tagtagccgg gcagctgcac gggcttcttg gccatgtaga tggacttgaa

      481 ctccaccagg tagtggccgc cgtccttcag cttcagggcc ttgtggatct cgcccttcag

      541 cacgccgtcg cgggggtaca ggcgctcggt ggaggcctcc cagcccatgg tcttcttctg

      601 cattacgggg ccgtcggagg ggaagttcac gccgatgaac ttcaccttgt agatgaagca

      661 gccgtcctgc agggaggagt cctgggtcac ggtcaccacg ccgccgtcct cgaagttcat

      721 cacgcgctcc cacttgaagc cctcggggaa ggacagcttc ttgtagtcgg ggatgtcggc

      781 ggggtgcttc acgtacacct tggagccgta ctggaactgg ggggacagga tgtcccaggc

      841 gaagggcagg gggccgccct tggtcacctt cagcttcacg gtgttgtggc cctcgtaggg

      901 gcggccctcg ccctcgccct cgatctcgaa ctcgtggccg ttcacggtgc cctccatgcg

      961 caccttgaag cgcatgaact ccttgatgac gttcttggag gagcgcgcca tggcaaagat

     1021 ctgcatctgt taatcagaaa aactcagatt aatcgacaaa ttcgatcgca caaactagaa

     1081 actaacacca gatctagata gaaatcacaa atcgaagagt aattattcga caaaactcaa

     1141 attatttgaa caaatcggat gatatctatg aaaccctaat cgagaattaa gatgatatct

     1201 aacgatcaaa cccagaaaat cgtcttcgat ctaagattaa cagaatctaa accaaagaac

     1261 atatacgaaa ttgggatcga acgaaaacaa aatcgaagat tttgagagaa taaggaacac

     1321 agaaatttac cttgatcacg gtagagagaa ttgagagaaa gtttttaaga ttttgagaaa

     1381 ttgaaatctg aattgtgaag aagaagagct ctttgggtat tgttttatag aagaagaaga

     1441 agaaaagacg aggacgacta ggtcacgaga aagctaaggc ggtgaagcaa tagctaataa

     1501 taaaatgaca cgtgtattga gcgttgttta cacgcaaagt tgtttttggc taattgcctt

     1561 atttttaggt tgaggaaaag tatttgtgct ttgagttgat aaacacgact cgtgtgtgcc

     1621 ggctgcaacc actttgacgc cgtttattac tggacttcgt ccgacaacca caatttcctt

     1681 aacggtcgtc ataagatcca gccgttgaga tttaacgatc gttacgattt atattttttt

     1741 agcattatcg ttttattttt taaatatacg gtggagctga aaattggcaa taattgaacc

     1801 gtgggtccca ctgcattgaa gcgtatttcg tattttctag aattcttcgt gctttatttc

     1861 ttttcctttt tgtttttttt tgccatttat ctaatgcaag tgggcttata aaatcagtga

     1921 atttcttgga aaagtaactt ctttatcgta taacatattg tgaaattatc catttctttt

     1981 aattttttta gtgttattgg atatttttgt atgattattg atttgcatag gataatgact

     2041 tttgtatcaa gttggtgaac aagtctcgtt aaaaaaggca agtggtttgg tgactcgatt

     2101 tattcttgtt atttaattca tatatcaatg gatcttattt ggggcctggt ccatatttaa

     2161 cactcgtgtt cagtccaatg accaataata ttttttcatt aataacaatg taacaagaat

     2221 gatacacaaa acattctttg aataagttcg ctatgaagaa gggaacttat ccggtcctag

     2281 atcatcagtt catacaaacc tccatagagt tcaacatctt aaacaagaat atcctgatct

     2341 gaagaatgtg gaggctttag tcccttggat acttgggagg ctgtggaaga acagaaacga

     2401 gctggtgctt aaagggaggg aatttggaac caatgaggta ttagtaagga cacaagaaga

     2461 tgcagatgag tggattagaa ggaaagaggc tcagaatgta aggaaagcac caaccacaac

     2521 gacgtcgcat gcctgcaggt cactggattt tggttttagg aattagaaat tttattgata

     2581 gaagtatttt acaaatacaa atacatacta agggtttctt atatgctcaa cacatgagcg

     2641 aaaccctata agaaccctaa ttcccttatc tgggaactac tcacacatta ttctggagaa

     2701 aaatagagag agatagattt gtagagagag actggtgatt tttgcggact ctagcatggc

     2761 cgcgggatat cacaagtttg tacaaaaaag ctgaacgaga aacgtaaaat gatataaata

     2821 tcaatatatt aaattagatt ttgcataaaa aacagactac ataatactgt aaaacacaac

     2881 atatccagtc actatggcgg ccgcattagg caccccaggc tttacacttt atgcttccgg

     2941 ctcgtataat gtgtggattt tgagttagga tccggcttac taaaagccag ataacagtat

     3001 gcgtatttgc gcgctgattt ttgcggtata agaatatata ctgatatgta tacccgaagt

     3061 atgtcaaaaa gaggtgtgct atgaagcagc gtattacagt gacagttgac agcgacagct

     3121 atcagttgct caaggcatat atgatgtcaa tatctccggt ctggtaagca caaccatgca

     3181 gaatgaagcc cgtcgtctgc gtgccgaacg ctggaaagcg gaaaatcagg aagggatggc

     3241 tgaggtcgcc cggtttattg aaatgaacgg ctcttttgct gacgagaaca gggactggtg

     3301 aaatgcagtt taaggtttac acctataaaa gagagagccg ttatcgtctg tttgtggatg

     3361 tacagagtga tattattgac acgcccgggc gacggatggt gatccccctg gccagtgcac

     3421 gtctgctgtc agataaagtc tcccgtgaac tttacccggt ggtgcatatc ggggatgaaa

     3481 gctggcgcat gatgaccacc gatatggcca gtgtgccggt ctccgttatc ggggaagaag

     3541 tggctgatct cagccaccgc gaaaatgaca tcaaaaacgc cattaacctg atgttctggg

     3601 gaatataaat gtcaggctcc cttatacaca gccagtctgc aggtcgacca tagtgactgg

     3661 atatgttgtg ttttacagta ttatgtagtc tgttttttat gcaaaatcta atttaatata

     3721 ttgatattta tatcatttta cgtttctcgt tcagctttct tgtacaaagt ggtgatatca

     3781 ctagtgcggc cgcctgcagg tcgaccatat ggtcgacctg caggcggccg cactagtgat

     3841 gctgttatgt tcagtgtcaa gctgacctgc aaacacgtta aatgctaaga agttagaata

     3901 tatgagacac gttaactggt atatgaataa gctgtaaata accgagtata aactcattaa

     3961 ctaatatcac ctctagagta taatataatc aaattcgaca atttgacttt caagagtagg

     4021 ctaatgtaaa atctttatat atttctacaa tgttcaaaga aacagttgca tctaaacccc

     4081 tatggccatc aaattcaatg aacgctaagc tgatccggcg agattttcag gagctaagga

     4141 agctaaaatg gagaaaaaaa tcactggata taccaccgtt gatatatccc aatggcatcg

     4201 taaagaacat tttgaggcat ttcagtcagt tgctcaatgt acctataacc agaccgttca

     4261 gctggatatt acggcctttt taaagaccgt aaagaaaaat aagcacaagt tttatccggc

     4321 ctttattcac attcttgccc gcctgatgaa tgctcatccg gaattccgta tggcaatgaa

     4381 agacggtgag ctggtgatat gggatagtgt tcacccttgt tacaccgttt tccatgagca

     4441 aactgaaacg ttttcatcgc tctggagtga ataccacgac gatttccggc agtttctaca

     4501 catatattcg caagatgtgg cgtgttacgg tgaaaacctg gcctatttcc ctaaagggtt

     4561 tattgagaat atgtttttcg tctcagccaa tccctgggtg agtttcacca gttttgattt

     4621 aaacgtggcc aatatggaca acttcttcgc ccccgttttc accatgggca aatattatac

     4681 gcaaggcgac aaggtgctga tgccgctggc gattcaggtt catcatgccg tctgtgatgg

     4741 cttccatgtc ggcagaatgc ttaatgaatt acaacagtac tgcgatgagt ggcagggcgg

     4801 ggcgtaaacg cgtggatcag cttaatatga ctctcaataa agtctcatac caacaagtgc

     4861 caccttattc aaccatcaag aaaaaagcca aaatttatgc tactctaagg aaaacttcac

     4921 taaagaagac gatttagagt gttttaccaa gaatttctgt catcttacta aacaactaaa

     4981 gatcggtgtg atacaaaacc taatctcatt aaagtttatg ctaaaataag cataatttta

     5041 cccactaagc gtgaccagat aaacataact cagcacacca gagcatatat attggtggct

     5101 caaatcatag aaacttacag tgaagacaca gaaagccgta agaagaggca agagtatgaa

     5161 accttacctc atcatttcca tgaggttgct tctgatcccg cgggatatca ccactttgta

     5221 caagaaagct gaacgagaaa cgtaaaatga tataaatatc aatatattaa attagatttt

     5281 gcataaaaaa cagactacat aatactgtaa aacacaacat atccagtcac tatggtcgac

     5341 ctgcagactg gctgtgtata agggagcctg acatttatat tccccagaac atcaggttaa

     5401 tggcgttttt gatgtcattt tcgcggtggc tgagatcagc cacttcttcc ccgataacgg

     5461 agaccggcac actggccata tcggtggtca tcatgcgcca gctttcatcc ccgatatgca

     5521 ccaccgggta aagttcacgg gagactttat ctgacagcag acgtgcactg gccaggggga

     5581 tcaccatccg tcgcccgggc gtgtcaataa tatcactctg tacatccaca aacagacgat

     5641 aacggctctc tcttttatag gtgtaaacct taaactgcat ttcaccagtc cctgttctcg

     5701 tcagcaaaag agccgttcat ttcaataaac cgggcgacct cagccatccc ttcctgattt

     5761 tccgctttcc agcgttcggc acgcagacga cgggcttcat tctgcatggt tgtgcttacc

     5821 agaccggaga tattgacatc atatatgcct tgagcaactg atagctgtcg ctgtcaactg

     5881 tcactgtaat acgctgcttc atagcacacc tctttttgac atacttcggg tatacatatc

     5941 agtatatatt cttataccgc aaaaatcagc gcgcaaatac gcatactgtt atctggcttt

     6001 tagtaagccg gatcctaact caaaatccac acattatacg agccggaagc ataaagtgta

     6061 aagcctgggg tgcctaatgc ggccgccata gtgactggat atgttgtgtt ttacagtatt

     6121 atgtagtctg ttttttatgc aaaatctaat ttaatatatt gatatttata tcattttacg

     6181 tttctcgttc agcttttttg tacaaacttg tgatatcact agtgcggccg cctgcaggtc

     6241 gactagaata gtaaattgta atgttgtttg ttgtttgttt tgttgtggta attgttgtaa

     6301 aaatacggat cgtcctgcag tcctctccaa atgaaatgaa cttccttata tagaggaagg

     6361 gtcttgcgaa ggatagtggg attgtgcgtc atcccttacg tcagtggaga tatcacatca

     6421 atccacttgc tttgaagacg tggttggaac gtcttctttt tccacgatgc tcctcgtggg

     6481 tgggggtcca tctttgggac cactgtcggc agaggcatct tgaacgatag cctttccttt

     6541 atcgcaatga tggcatttgt aggtgccacc ttccttttct actgtccttt tgatgaagtg

     6601 acagatagct gggcaatgga atccgaggag gtttcccgat attacccttt gttgaaaagt

     6661 ctcaatagcc ctttggtctt ctgagactgt atctttgata ttcttggagt agacgagagt

     6721 gtcgtgctcc accatgttga cgaagatttt cttcttgtca ttgagtcgta aaagactctg

     6781 tatgaactgt tcgccagtct tcacggcgag ttctgttaga tcctcgatct gaatttttga

     6841 ctccatggcc tttgattcag taggaactac tttcttagag actccaatct ctattacttg

     6901 ccttggttta tgaagcaagc cttgaatcgt ccatactgga atagtacttc tgatcttgag

     6961 aaatatatct ttctctgtgt tcttgatgca gttagtcctg aatcttttga ctgcatcttt

     7021 aaccttcttg ggaaggtatt tgatctcctg gagattatta ctcgggtaga tcgtcttgat

     7081 gagacctgcc gcgtaggcct ctctaaccat ctgtgggtca gcattctttc tgaaattgaa

     7141 gaggctaatc ttctcattat cggtggtgaa catggtatcg tcaccttctc cgtcgaactt

     7201 tcttcctaga tcgtagagat agagaaagtc gtccatggtg atctccgggg caaaggagat

     7261 cagcttggct ctagtcgacc atatgggaga gctcaagctt agcttgagct tggatcagat

     7321 tgtcgtttcc cgccttcagt ttaaactatc agtgtttgac aggatatatt ggcgggtaaa

     7381 cctaagagaa aagagcgttt attagaataa cggatattta aaagggcgtg aaaaggttta

     7441 tccgttcgtc catttgtatg tgcatgccaa ccacagggtt cccctcggga tcaaagtact

     7501 ttgatccaac ccctccgctg ctatagtgca gtcggcttct gacgttcagt gcagccgtct

     7561 tctgaaaacg acatgtcgca caagtcctaa gttacgcgac aggctgccgc cctgcccttt

     7621 tcctggcgtt ttcttgtcgc gtgttttagt cgcataaagt agaatacttg cgactagaac

     7681 cggagacatt acgccatgaa caagagcgcc gccgctggcc tgctgggcta tgcccgcgtc

     7741 agcaccgacg accaggactt gaccaaccaa cgggccgaac tgcacgcggc cggctgcacc

     7801 aagctgtttt ccgagaagat caccggcacc aggcgcgacc gcccggagct ggccaggatg

     7861 cttgaccacc tacgccctgg cgacgttgtg acagtgacca ggctagaccg cctggcccgc

     7921 agcacccgcg acctactgga cattgccgag cgcatccagg aggccggcgc gggcctgcgt

     7981 agcctggcag agccgtgggc cgacaccacc acgccggccg gccgcatggt gttgaccgtg

     8041 ttcgccggca ttgccgagtt cgagcgttcc ctaatcatcg accgcacccg gagcgggcgc

     8101 gaggccgcca aggcccgagg cgtgaagttt ggcccccgcc ctaccctcac cccggcacag

     8161 atcgcgcacg cccgcgagct gatcgaccag gaaggccgca ccgtgaaaga ggcggctgca

     8221 ctgcttggcg tgcatcgctc gaccctgtac cgcgcacttg agcgcagcga ggaagtgacg

     8281 cccaccgagg ccaggcggcg cggtgccttc cgtgaggacg cattgaccga ggccgacgcc

     8341 ctggcggccg ccgagaatga acgccaagag gaacaagcat gaaaccgcac caggacggcc

     8401 aggacgaacc gtttttcatt accgaagaga tcgaggcgga gatgatcgcg gccgggtacg

     8461 tgttcgagcc gcccgcgcac gtctcaaccg tgcggctgca tgaaatcctg gccggtttgt

     8521 ctgatgccaa gctggcggcc tggccggcca gcttggccgc tgaagaaacc gagcgccgcc

     8581 gtctaaaaag gtgatgtgta tttgagtaaa acagcttgcg tcatgcggtc gctgcgtata

     8641 tgatgcgatg agtaaataaa caaatacgca aggggaacgc atgaaggtta tcgctgtact

     8701 taaccagaaa ggcgggtcag gcaagacgac catcgcaacc catctagccc gcgccctgca

     8761 actcgccggg gccgatgttc tgttagtcga ttccgatccc cagggcagtg cccgcgattg

     8821 ggcggccgtg cgggaagatc aaccgctaac cgttgtcggc atcgaccgcc cgacgattga

     8881 ccgcgacgtg aaggccatcg gccggcgcga cttcgtagtg atcgacggag cgccccaggc

     8941 ggcggacttg gctgtgtccg cgatcaaggc agccgacttc gtgctgattc cggtgcagcc

     9001 aagcccttac gacatatggg ccaccgccga cctggtggag ctggttaagc agcgcattga

     9061 ggtcacggat ggaaggctac aagcggcctt tgtcgtgtcg cgggcgatca aaggcacgcg

     9121 catcggcggt gaggttgccg aggcgctggc cgggtacgag ctgcccattc ttgagtcccg

     9181 tatcacgcag cgcgtgagct acccaggcac tgccgccgcc ggcacaaccg ttcttgaatc

     9241 agaacccgag ggcgacgctg cccgcgaggt ccaggcgctg gccgctgaaa ttaaatcaaa

     9301 actcatttga gttaatgagg taaagagaaa atgagcaaaa gcacaaacac gctaagtgcc

     9361 ggccgtccga gcgcacgcag cagcaaggct gcaacgttgg ccagcctggc agacacgcca

     9421 gccatgaagc gggtcaactt tcagttgccg gcggaggatc acaccaagct gaagatgtac

     9481 gcggtacgcc aaggcaagac cattaccgag ctgctatctg aatacatcgc gcagctacca

     9541 gagtaaatga gcaaatgaat aaatgagtag atgaatttta gcggctaaag gaggcggcat

     9601 ggaaaatcaa gaacaaccag gcaccgacgc cgtggaatgc cccatgtgtg gaggaacggg

     9661 cggttggcca ggcgtaagcg gctgggttgt ctgccggccc tgcaatggca ctggaacccc

     9721 caagcccgag gaatcggcgt gacggtcgca aaccatccgg cccggtacaa atcggcgcgg

     9781 cgctgggtga tgacctggtg gagaagttga aggccgcgca ggccgcccag cggcaacgca

     9841 tcgaggcaga agcacgcccc ggtgaatcgt ggcaagcggc cgctgatcga atccgcaaag

     9901 aatcccggca accgccggca gccggtgcgc cgtcgattag gaagccgccc aagggcgacg

     9961 agcaaccaga ttttttcgtt ccgatgctct atgacgtggg cacccgcgat agtcgcagca

    10021 tcatggacgt ggccgttttc cgtctgtcga agcgtgaccg acgagctggc gaggtgatcc

    10081 gctacgagct tccagacggg cacgtagagg tttccgcagg gccggccggc atggccagtg

    10141 tgtgggatta cgacctggta ctgatggcgg tttcccatct aaccgaatcc atgaaccgat

    10201 accgggaagg gaagggagac aagcccggcc gcgtgttccg tccacacgtt gcggacgtac

    10261 tcaagttctg ccggcgagcc gatggcggaa agcagaaaga cgacctggta gaaacctgca

    10321 ttcggttaaa caccacgcac gttgccatgc agcgtacgaa gaaggccaag aacggccgcc

    10381 tggtgacggt atccgagggt gaagccttga ttagccgcta caagatcgta aagagcgaaa

    10441 ccgggcggcc ggagtacatc gagatcgagc tagctgattg gatgtaccgc gagatcacag

    10501 aaggcaagaa cccggacgtg ctgacggttc accccgatta ctttttgatc gatcccggca

    10561 tcggccgttt tctctaccgc ctggcacgcc gcgccgcagg caaggcagaa gccagatggt

    10621 tgttcaagac gatctacgaa cgcagtggca gcgccggaga gttcaagaag ttctgtttca

    10681 ccgtgcgcaa gctgatcggg tcaaatgacc tgccggagta cgatttgaag gaggaggcgg

    10741 ggcaggctgg cccgatccta gtcatgcgct accgcaacct gatcgagggc gaagcatccg

    10801 ccggttccta atgtacggag cagatgctag ggcaaattgc cctagcaggg gaaaaaggtc

    10861 gaaaaggtct ctttcctgtg gatagcacgt acattgggaa cccaaagccg tacattggga

    10921 accggaaccc gtacattggg aacccaaagc cgtacattgg gaaccggtca cacatgtaag

    10981 tgactgatat aaaagagaaa aaaggcgatt tttccgccta aaactcttta aaacttatta

    11041 aaactcttaa aacccgcctg gcctgtgcat aactgtctgg ccagcgcaca gccgaagagc

    11101 tgcaaaaagc gcctaccctt cggtcgctgc gctccctacg ccccgccgct tcgcgtcggc

    11161 ctatcgcggc cgctggccgc tcaaaaatgg ctggcctacg gccaggcaat ctaccagggc

    11221 gcggacaagc cgcgccgtcg ccactcgacc gccggcgccc acatcaaggc accctgcctc

    11281 gcgcgtttcg gtgatgacgg tgaaaacctc tgacacatgc agctcccgga gacggtcaca

    11341 gcttgtctgt aagcggatgc cgggagcaga caagcccgtc agggcgcgtc agcgggtgtt

    11401 ggcgggtgtc ggggcgcagc catgacccag tcacgtagcg atagcggagt gtatactggc

    11461 ttaactatgc ggcatcagag cagattgtac tgagagtgca ccatatgcgg tgtgaaatac

    11521 cgcacagatg cgtaaggaga aaataccgca tcaggcgctc ttccgcttcc tcgctcactg

    11581 actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa

    11641 tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc

    11701 aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc

    11761 ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat

    11821 aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc

    11881 cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct

    11941 cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg

    12001 aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc

    12061 cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga

    12121 ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa

    12181 ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta

    12241 gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc

    12301 agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg

    12361 acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgcatgat atatctccca

    12421 atttgtgtag ggcttattat gcacgcttaa aaataataaa agcagacttg acctgatagt

    12481 ttggctgtga gcaattatgt gcttagtgca tctaatcgct tgagttaacg ccggcgaagc

    12541 ggcgtcggct tgaacgaatt tctagctaga cattatttgc cgactacctt ggtgatctcg

    12601 cctttcacgt agtggacaaa ttcttccaac tgatctgcgc gcgaggccaa gcgatcttct

    12661 tcttgtccaa gataagcctg tctagcttca agtatgacgg gctgatactg ggccggcagg

    12721 cgctccattg cccagtcggc agcgacatcc ttcggcgcga ttttgccggt tactgcgctg

    12781 taccaaatgc gggacaacgt aagcactaca tttcgctcat cgccagccca gtcgggcggc

    12841 gagttccata gcgttaaggt ttcatttagc gcctcaaata gatcctgttc aggaaccgga

    12901 tcaaagagtt cctccgccgc tggacctacc aaggcaacgc tatgttctct tgcttttgtc

    12961 agcaagatag ccagatcaat gtcgatcgtg gctggctcga agatacctgc aagaatgtca

    13021 ttgcgctgcc attctccaaa ttgcagttcg cgcttagctg gataacgcca cggaatgatg

    13081 tcgtcgtgca caacaatggt gacttctaca gcgcggagaa tctcgctctc tccaggggaa

    13141 gccgaagttt ccaaaaggtc gttgatcaaa gctcgccgcg ttgtttcatc aagccttacg

    13201 gtcaccgtaa ccagcaaatc aatatcactg tgtggcttca ggccgccatc cactgcggag

    13261 ccgtacaaat gtacggccag caacgtcggt tcgagatggc gctcgatgac gccaactacc

    13321 tctgatagtt gagtcgatac ttcggcgatc accgcttccc ccatgatgtt taactttgtt

    13381 ttagggcgac tgccctgctg cgtaacatcg ttgctgctcc ataacatcaa acatcgaccc

    13441 acggcgtaac gcgcttgctg cttggatgcc cgaggcatag actgtacccc aaaaaaacat

    13501 gtcataacaa gaagccatga aaaccgccac tgcgccgtta ccaccgctgc gttcggtcaa

    13561 ggttctggac cagttgcgtg acggcagtta cgctacttgc attacagctt acgaaccgaa

    13621 cgaggcttat gtccactggg ttcgtgcccg aattgatcac aggcagcaac gctctgtcat

    13681 cgttacaatc aacatgctac cctccgcgag atcatccgtg tttcaaaccc ggcagcttag

    13741 ttgccgttct tccgaatagc atcggtaaca tgagcaaagt ctgccgcctt acaacggctc

    13801 tcccgctgac gccgtcccgg actgatgggc tgcctgtatc gagtggtgat tttgtgccga

    13861 gctgccggtc ggggagctgt tggctggctg gtggcaggat atattgtggt gtaaacaaat

    13921 tgacgcttag acaacttaat aacacattgc ggacgttttt aatgtactga attaacgccg

    13981 aattgaatta tcagcttgca tgccggtcga tctagtaaca tagatgacac cgcgcgcgat

    14041 aatttatcct agtttgcgcg ctatattttg ttttctatcg cgtattaaat gtataattgc

    14101 gggactctaa tcataaaaac ccatctcata aataacgtca tgcattacat gttaattatt

    14161 acatgcttaa cgtaattcaa cagaaattat atgataatca tcgcaagacc ggcaacagga

    14221 ttcaatctta agaaacttta ttgccaaatg tttgaacgat ctgcttgact ctagctagag

    14281 tccgaacccc agagtcccgc tcagaagaac tcgtcaagaa ggcgatagaa ggcgatgcgc

    14341 tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc ggtcagccca ttcgccgcca

    14401 agctcttcag caatatcacg ggtagccaac gctatgtcct gatagcggtc cgccacaccc

    14461 agccggccac agtcgatgaa tccagaaaag cggccatttt ccaccatgat attcggcaag

    14521 caggcatcgc cgtgggtcac gacgagatcc tcgccgtcgg gcatccgcgc cttgagcctg

    14581 gcgaacagtt cggctggcgc gagcccctga tgctcttcgt ccagatcatc ctgatcgaca

    14641 agaccggctt ccatccgagt acgtgctcgc tcgatgcgat gtttcgcttg gtggtcgaat

    14701 gggcaggtag ccggatcaag cgtatgcagc cgccgcattg catcagccat gatggatact

    14761 ttctcggcag gagcaaggtg agatgacagg agatcctgcc ccggcacttc gcccaatagc

    14821 agccagtccc ttcccgcttc agtgacaacg tcgagcacag ctgcgcaagg aacgcccgtc

    14881 gtggccagcc acgatagccg cgctgcctcg tcttggagtt cattcagggc accggacagg

    14941 tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca gccggaacac ggcggcatca

    15001 gagcagccga ttgtctgttg tgcccagtca tagccgaata gcctctccac ccaagcggcc

    15061 ggagaacctg cgtgcaatcc atcttgttca atcatgcctc gatcgagttg agagtgaata

    15121 tgagactcta attggatacc gaggggaatt tatggaacgt cagtggagca tttttgacaa

    15181 gaaatatttg ctagctgata gtgaccttag gcgacttttg aacgcgcaat aatggtttct

    15241 gacgtatgtg cttagctcat taaactccag aaacccgcgg ctgagtggct ccttcaacgt

    15301 tgcggttctg tcagttccaa acgtaaaacg gcttgtcccg cgtcatcggc gggggtcata

    15361 acgtgactcc cttaattctc atgtatgata attcgagggt acccggggat cct


1.  This product is FOR RESEARCH USE ONLY!
2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
