PL99

$193.00

  • Model: PVT11340
  • 50 Units in Stock
Ask a question


Add to Cart:

PL99

Catalog No. PVT11340
Packing 2ug

 

PL99 Information
Resistance:  Apr
Growing Strain: DH5α
Growing Condition: LB 37℃

 

PL99 Sequence

> fd-term-F 5'-GCATGCTAAACCGATACAATT-3'
ACTCCCTTATGCGGGTGGCGCAGAATGCCAGGACCCTTGTCATTCCACGTCAATTCATGCGCCTTTTCAC
CTCGTACTGTCCTGCCAAACACAAGCAACGGAGGTACGCATATGCTGGACGGCGGATCCGCCGATATCGC
CAAGCTTCAGAGATCTTAAACCGATACAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTTGGAGGCGAACT
CCCTTATGCGGGTGGCGCAGAATGCCAGGACCCTTGTCATTCCACGTCAATTCATGCGCCTTTTCACCTC
GTACTGTCCTGCCAAACACAAGCAACGGAGGTACGGACATGAACACCTTCTTCTCCTCCGACCAGGTCTC
GGCGCCCGACCGCGTCGCGCTCTGGCACGACGTCATCTGCCGCAGCTACGTCCCGCTGAACATCACCCTG
ACCAGCGAGCAGCCCTTCATCGGCACCGTCTCCACCGGCAACCTGGGCACCGTCCGCATCGCCACGTCCT
CGTCCCTGCCCCAGCAGATCACCCGCACCCGCCGCCTGATCCGCCAGGACGAGCGCGAGTACCTCATGGT
CGGCGTGCAGTCCGCCGGCCACGCCCTCGTGCAGCAGCACGGCCGCACCGCCCGCGTCGGCCGCGGCGGC
CTGGTCTTCTGGGACACCCGCCACCCGTACGACATCCTCTTCCCGACCGACTGGCGCATGAGCGTCTTCC
AGTTCCCGCGCTACTCCTTCGGCTTCACCGAGGACTTCATCGGCCGCATGACCGCCGTCAACGTCGGCGG
CGACCGCGGCATCGGCCGCGTGGTCTCCTCCTTCATGACCAGCATCAACGACGCGACCGACGCCGGCGAA
CCTGGCGGA
        

> aac3IV-R 5'-ccattcgtattgcacgacat-3'
ATCATAGCACGATCAACGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGAT
GGAGCTGCACATGAACCAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTA
ACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTT
TTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATC
AAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCT
AGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATC
CTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTAC
CGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTA
CACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGAC
AGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGT
ATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGG
GCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCT
CACATGTTCTTTCCTGCG

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart