pLEGFP- N1

$215.00

  • Model: PVT11086
  • 50 Units in Stock
Ask a question


Add to Cart:

pLEGFP-N1

 
PVT11086  Packing 2ug
 
 
pLEGFP-N1 Informaiton
 
Promotor: CMV
Cloning Method: Unknown
Size: 4700
5' Sequencing 1 Primer: CMV-F, EGFP-N
5' Sequencing 1 Primer Sequence: 5'd[CGTCGCCGTCCAGCTCGACCAG]3'
Tag 1: EGFP (Cterm)
Bacterial Resistance: Kan
Selectable Marker: Neo
 
 
 
No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart