Plenti CMV Puro DEST

$280.00

  • Model: PVTY00740
  • 20 Units in Stock
Ask a question


Add to Cart:

Plenti CMV Puro DEST

PVTY00740  2ug

Plenti CMV Puro DEST Description

Plasmid type: Lentiviral vector Copy Number: High copy Promoter: CMV Size: 9617 bp 5' Sequencing primers and sequences: CMV-F: CGCAAATGGGCGGTAGGCGTG Resistance(s): Ampicillin (Amp) Selectable markers: Puromycin Note: Host strain
No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart