pLenti6/V5-DEST

$280.00

  • Model: PVTY00619
  • 20 Units in Stock
Ask a question


Add to Cart:

pLenti6/V5-DEST

PVTY00619  2ug

pLenti6/V5-DEST Description

Plasmid type: Lentiviral vector Promoter: CMV Cloning Method: Gateway Size: 8688 bp 5' Sequencing primers and sequences: CMVPro Fwd: 5'd[CGCAAATGGGCGGTAGGCGTG]3' Tags: V5 Resistance(s): Ampicillin (Amp) Selectable markers: Blasticidin

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart