pLJM1

PVT2319  Packing 2μg

pLJM1 Information

Promoter: hPGK, CMV, T3
Replicator: SV40 Ori, F1 Ori
Terminator: SV40 poly (A) signal
Plasmid classification: virus series, lentivirus cloning vector
Plasmid size: 7400bp
Prokaryotic resistance: Amp
Screening markers: Puro
Cloned strain: Stbl3
Culture conditions: 37 centigrade, aerobic LB
Expression host: mammalian cells
Induction mode: no induction, instantaneous expression
5'sequencing primers: CMV-F:CGCAAATGGGCGGTAGGCGTG
3'sequencing primers: primers designed according to sequence
Use:Lentiviral

PVT2319 pLJM1  Reference

ARTICLE：An Improved αvβ6-Receptor-Expressing Suspension Cell Line for Foot-and-Mouth Disease Vaccine Production

Authors:Yongjie Harvey , Ben Jackson , Brigid Veronica Carr , Kay Childs 1, Katy Moffat 1, Graham Freimanis 1 , Chandana Tennakoon 1, Nicholas Juleff 2 and Julian Seago 1,

Viruses 2022, 14(3), 621; https://doi.org/10.3390/v14030621
Received: 21 January 2022 / Accepted: 15 March 2022 / Published: 16 March 2022

Caution:
1.  This product is FOR RESEARCH USE ONLY!
2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.
 

Search name

pLJM1,Plasmid pLJM1,pLJM1 vector