pLJM1

$182.00

  • Model: PVT2319
  • 50 Units in Stock
Ask a question


Add to Cart:

pLJM1

Packing 20μl

 

Search name

pLJM1,Plasmid pLJM1,pLJM1 vector

 

pLJM1 Information

Promoter: hPGK, CMV, T3
Replicator: SV40 Ori, F1 Ori
Terminator: SV40 poly (A) signal
Plasmid classification: virus series, lentivirus cloning vector
Plasmid size: 7400bp
Prokaryotic resistance: Amp
Screening markers: Puro
Cloned strain: Stbl3
Culture conditions: 37 centigrade, aerobic LB
Expression host: mammalian cells
Induction mode: no induction, instantaneous expression
5'sequencing primers: CMV-F:CGCAAATGGGCGGTAGGCGTG
3'sequencing primers: primers designed according to sequence
Use:Lentiviral

 

Caution:
Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart