pLKO- p53- shRNA- 941


  • Model: PVT10412
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT10412
Packing 2ug


pLKO-p53-shRNA-941 Information

Function RNA transcription plasmid

Promoter: U6 promoter

Replicator: pUC ori, F1 ori, SV40 ori

Terminator: cPPT/CTS, 3

Plasmid classification: RNA library plasmid; RNA human plasmid; shRNA human plasmid.

Plasmid size: 7083bp

Prokaryotic resistance: Amp (100 mu g/ml)

Screening markers: Puro

Cloned strain: Stbl3

Culture conditions: 37 centigrade, LB, aerobic

Expression host: mammalian cells such as 293T

Culture conditions: 37 C, 5%CO2

Induction mode: no induction

5'sequencing primers: U6-F (ATGGACTATCATATGCTTACCGTA)

3'sequencing primers: pLKO-R (CTGCACTGTACCCCCCAATC)





pLKO-p53-shRNA-941 Desccription

PLKO-p53-shRNA-941 is a mammalian lentivirus RNA interference plasmid cloned from a shRNA sequence on pLKO.1-Puro vector. U6 can initiate transcription of P53shRNA-941, which specifically interferes with the expression of P53 protein. The plasmid can be directly transfected into mammalian cells as a common overexpression plasmid, and can also be packaged into lentivirus infecting cells. The plasmid itself contains a Puro screening marker. The positive cells can be screened by purpuamycin.


pLKO-p53-shRNA-941 Sequence

LOCUS       Exported                7083 bp ds-DNA    circular SYN 09-JUL-2017
KEYWORDS    pLKO.1-p53shRNA-941
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 7083)
  TITLE     Direct Submission
  JOURNAL   Exported 2017-07-09  
FEATURES             Location/Qualifiers
     source          1..7083
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             529..1128
                     /gene="pac from Streptomyces alboniger"
                     /product="puromycin N-acetyltransferase"
                     /note="confers resistance to puromycin"
     LTR             1256..1489
                     /note="3' LTR (Delta-U3)"
                     /note="self-inactivating 3' long terminal repeat (LTR) from
     polyA_signal    1561..1682
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      1722..1857
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     promoter        complement(1878..1896)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     primer_bind     complement(1906..1922)
                     /note="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
     rep_origin      2064..2519
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        2545..2649
                     /note="AmpR promoter"
     CDS             2650..3510
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      3681..4269
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     protein_bind    4557..4578
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        4593..4623
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    4631..4647
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     4655..4671
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar
     promoter        4692..4710
                     /note="T3 promoter"
                     /note="promoter for bacteriophage T3 RNA polymerase"
     promoter        4736..4964
                     /note="RSV promoter"
                     /note="Rous sarcoma virus enhancer/promoter"
     LTR             4965..5145
                     /note="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    5192..5317
                     /note="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    5810..6043

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
