pLKO.1- GFPshRNA- Puro


  • Model: PVT11394
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT11394
Packing 2ug


pLKO.1-GFPshRNA-Puro Information
Function RNA plasmids

Promoter: U6 promoter

Replicon: pUC ori, F1 ori, SV40 ori

Terminator: cPPT/CTS, 3 LTR (U3), SV40 poly (A) signal

Plasmid classification: RNA library plasmids; other RNA plasmids; other shRNA plasmids

Plasmid size: 7091 BP

Prokaryotic resistance: Amp (100 ug/ml)

Screening Marker: Puro

Cloning strain: Stbl3

Culture conditions: 37℃, LB, aerobic

Expressing host: mammalian cells such as 293T

Culture conditions: 37℃, 5% CO2

Induction: No Induction


3'Sequencing primers: pLKO-R (CTGCACTGTACCCCCCAATC)

pLKO.1-GFPshRNA-Puro Description

pLKO.1-GFPshRNA plasmid is a lentivirus RNA interference plasmid obtained by cloning a segment of GFPshRNA sequence on pLKO.1-Puro vector. U6 promotes the transcription of GFPshRNA, which can specifically interfere with the expression of GFP protein. The plasmid can be directly transfected into mammalian cells as a common overexpression plasmid or packaged into lentivirus-infected cells. The plasmid itself carries Puro screening marker, and the transfected cells can be screened by purinomycin to obtain positive clones.




pLKO.1-GFPshRNA-Puro Sequence


LOCUS       Exported                7091 bp ds-DNA    circular SYN 09-July-2017





SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 7091)

  AUTHORS  Nova lifetech

  TITLE     Direct Submission

  JOURNAL   Exported 2017-07-09

FEATURES             Location/Qualifiers

     source          1..7091

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     CDS             529..1128


                     /gene="pac from Streptomyces alboniger"

                     /product="puromycin N-acetyltransferase"


                     /note="confers resistance to puromycin"





     LTR             1256..1489

                     /note="3' LTR (Delta-U3)"

                     /note="self-inactivating 3' long terminal repeat (LTR) from


     polyA_signal    1561..1682

                     /note="SV40 poly(A) signal"

                     /note="SV40 polyadenylation signal"

     rep_origin      1722..1857

                     /note="SV40 ori"

                     /note="SV40 origin of replication"

     promoter        complement(1878..1896)

                     /note="T7 promoter"

                     /note="promoter for bacteriophage T7 RNA polymerase"

     primer_bind     complement(1906..1922)

                     /note="M13 fwd"

                     /note="common sequencing primer, one of multiple similar 


     rep_origin      2064..2519


                     /note="f1 ori"

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"

     promoter        2545..2649


                     /note="AmpR promoter"

     CDS             2650..3510





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     rep_origin      3681..4269



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     protein_bind    4557..4578

                     /bound_moiety="E. coli catabolite activator protein"

                     /note="CAP binding site"

                     /note="CAP binding activates transcription in the presence 

                     of cAMP."

     promoter        4593..4623

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    4631..4647

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     primer_bind     4655..4671

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     promoter        4692..4710

                     /note="T3 promoter"

                     /note="promoter for bacteriophage T3 RNA polymerase"

     promoter        4736..4964

                     /note="RSV promoter"

                     /note="Rous sarcoma virus enhancer/promoter"

     LTR             4965..5145

                     /note="5' LTR (truncated)"

                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"

     misc_feature    5192..5317

                     /note="HIV-1 Psi"

                     /note="packaging signal of human immunodeficiency virus 

                     type 1"

     misc_feature    5810..6043


                     /note="The Rev response element (RRE) of HIV-1 allows for 

                     Rev-dependent mRNA export from the nucleus to the 


     promoter        6570..6810

                     /label="U6 Promoter"

                     /note="U6 promoter"

                     /note="RNA polymerase III promoter for human U6 snRNA"

     misc_feature    6817..6880


     misc_feature    6922..7039


                     /note="central polypurine tract and central termination 

                     sequence of HIV-1"

     promoter        7088..507

                     /note="hPGK promoter"

                     /note="human phosphoglycerate kinase 1 promoter"


        1 ttggggttgc gccttttcca aggcagccct gggtttgcgc agggacgcgg ctgctctggg

       61 cgtggttccg ggaaacgcag cggcgccgac cctgggtctc gcacattctt cacgtccgtt

      121 cgcagcgtca cccggatctt cgccgctacc cttgtgggcc ccccggcgac gcttcctgct

      181 ccgcccctaa gtcgggaagg ttccttgcgg ttcgcggcgt gccggacgtg acaaacggaa

      241 gccgcacgtc tcactagtac cctcgcagac ggacagcgcc agggagcaat ggcagcgcgc

      301 cgaccgcgat gggctgtggc caatagcggc tgctcagcag ggcgcgccga gagcagcggc

      361 cgggaagggg cggtgcggga ggcggggtgt ggggcggtag tgtgggccct gttcctgccc

      421 gcgcggtgtt ccgcattctg caagcctccg gagcgcacgt cggcagtcgg ctccctcgtt

      481 gaccgaatca ccgacctctc tccccagggg gatccaccgg agcttaccat gaccgagtac

      541 aagcccacgg tgcgcctcgc cacccgcgac gacgtcccca gggccgtacg caccctcgcc

      601 gccgcgttcg ccgactaccc cgccacgcgc cacaccgtcg atccggaccg ccacatcgag

      661 cgggtcaccg agctgcaaga actcttcctc acgcgcgtcg ggctcgacat cggcaaggtg

      721 tgggtcgcgg acgacggcgc cgcggtggcg gtctggacca cgccggagag cgtcgaagcg

      781 ggggcggtgt tcgccgagat cggcccgcgc atggccgagt tgagcggttc ccggctggcc

      841 gcgcagcaac agatggaagg cctcctggcg ccgcaccggc ccaaggagcc cgcgtggttc

      901 ctggccaccg tcggcgtctc gcccgaccac cagggcaagg gtctgggcag cgccgtcgtg

      961 ctccccggag tggaggcggc cgagcgcgcc ggggtgcccg ccttcctgga gacctccgcg

     1021 ccccgcaacc tccccttcta cgagcggctc ggcttcaccg tcaccgccga cgtcgaggtg

     1081 cccgaaggac cgcgcacctg gtgcatgacc cgcaagcccg gtgcctgacg cccgccccac

     1141 gacccgcagc gcccgaccga aaggagcgca cgaccccatg catcggtacc tttaagacca

     1201 atgacttaca aggcagctgt agatcttagc cactttttaa aagaaaaggg gggactggaa

     1261 gggctaattc actcccaacg aagacaagat ctgctttttg cttgtactgg gtctctctgg

     1321 ttagaccaga tctgagcctg ggagctctct ggctaactag ggaacccact gcttaagcct

     1381 caataaagct tgccttgagt gcttcaagta gtgtgtgccc gtctgttgtg tgactctggt

     1441 aactagagat ccctcagacc cttttagtca gtgtggaaaa tctctagcag tagtagttca

     1501 tgtcatctta ttattcagta tttataactt gcaaagaaat gaatatcaga gagtgagagg

     1561 aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca

     1621 aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct

     1681 tatcatgtct ggctctagct atcccgcccc taactccgcc catcccgccc ctaactccgc

     1741 ccagttccgc ccattctccg ccccatggct gactaatttt ttttatttat gcagaggccg

     1801 aggccgcctc ggcctctgag ctattccaga agtagtgagg aggctttttt ggaggcctag

     1861 ggacgtaccc aattcgccct atagtgagtc gtattacgcg cgctcactgg ccgtcgtttt

     1921 acaacgtcgt gactgggaaa accctggcgt tacccaactt aatcgccttg cagcacatcc

     1981 ccctttcgcc agctggcgta atagcgaaga ggcccgcacc gatcgccctt cccaacagtt

     2041 gcgcagcctg aatggcgaat gggacgcgcc ctgtagcggc gcattaagcg cggcgggtgt

     2101 ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ctagcgcccg ctcctttcgc

     2161 tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc taaatcgggg

     2221 gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa aacttgatta

     2281 gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc ctttgacgtt

     2341 ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac tcaaccctat

     2401 ctcggtctat tcttttgatt tataagggat tttgccgatt tcggcctatt ggttaaaaaa

     2461 tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgc ttacaattta

     2521 ggtggcactt ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat

     2581 tcaaatatgt atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa

     2641 aggaagagta tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt

     2701 tgccttcctg tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag

     2761 ttgggtgcac gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt

     2821 tttcgccccg aagaacgttt tccaatgatg agcactttta aagttctgct atgtggcgcg

     2881 gtattatccc gtattgacgc cgggcaagag caactcggtc gccgcataca ctattctcag

     2941 aatgacttgg ttgagtactc accagtcaca gaaaagcatc ttacggatgg catgacagta

     3001 agagaattat gcagtgctgc cataaccatg agtgataaca ctgcggccaa cttacttctg

     3061 acaacgatcg gaggaccgaa ggagctaacc gcttttttgc acaacatggg ggatcatgta

     3121 actcgccttg atcgttggga accggagctg aatgaagcca taccaaacga cgagcgtgac

     3181 accacgatgc ctgtagcaat ggcaacaacg ttgcgcaaac tattaactgg cgaactactt

     3241 actctagctt cccggcaaca attaatagac tggatggagg cggataaagt tgcaggacca

     3301 cttctgcgct cggcccttcc ggctggctgg tttattgctg ataaatctgg agccggtgag

     3361 cgtgggtctc gcggtatcat tgcagcactg gggccagatg gtaagccctc ccgtatcgta

     3421 gttatctaca cgacggggag tcaggcaact atggatgaac gaaatagaca gatcgctgag

     3481 ataggtgcct cactgattaa gcattggtaa ctgtcagacc aagtttactc atatatactt

     3541 tagattgatt taaaacttca tttttaattt aaaaggatct aggtgaagat cctttttgat

     3601 aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta

     3661 gaaaagatca aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa

     3721 acaaaaaaac caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt

     3781 tttccgaagg taactggctt cagcagagcg cagataccaa atactgttct tctagtgtag

     3841 ccgtagttag gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta

     3901 atcctgttac cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca

     3961 agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag

     4021 cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa

     4081 agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga

     4141 acaggagagc gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc

     4201 gggtttcgcc acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc

     4261 ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt

     4321 gctcacatgt tctttcctgc gttatcccct gattctgtgg ataaccgtat taccgccttt

     4381 gagtgagctg ataccgctcg ccgcagccga acgaccgagc gcagcgagtc agtgagcgag

     4441 gaagcggaag agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa

     4501 tgcagctggc acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat

     4561 gtgagttagc tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg

     4621 ttgtgtggaa ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac

     4681 gccaagcgcg caattaaccc tcactaaagg gaacaaaagc tggagctgca agcttaatgt

     4741 agtcttatgc aatactcttg tagtcttgca acatggtaac gatgagttag caacatgcct

     4801 tacaaggaga gaaaaagcac cgtgcatgcc gattggtgga agtaaggtgg tacgatcgtg

     4861 ccttattagg aaggcaacag acgggtctga catggattgg acgaaccact gaattgccgc

     4921 attgcagaga tattgtattt aagtgcctag ctcgatacat aaacgggtct ctctggttag

     4981 accagatctg agcctgggag ctctctggct aactagggaa cccactgctt aagcctcaat

     5041 aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac tctggtaact

     5101 agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtggc gcccgaacag

     5161 ggacttgaaa gcgaaaggga aaccagagga gctctctcga cgcaggactc ggcttgctga

     5221 agcgcgcacg gcaagaggcg aggggcggcg actggtgagt acgccaaaaa ttttgactag

     5281 cggaggctag aaggagagag atgggtgcga gagcgtcagt attaagcggg ggagaattag

     5341 atcgcgatgg gaaaaaattc ggttaaggcc agggggaaag aaaaaatata aattaaaaca

     5401 tatagtatgg gcaagcaggg agctagaacg attcgcagtt aatcctggcc tgttagaaac

     5461 atcagaaggc tgtagacaaa tactgggaca gctacaacca tcccttcaga caggatcaga

     5521 agaacttaga tcattatata atacagtagc aaccctctat tgtgtgcatc aaaggataga

     5581 gataaaagac accaaggaag ctttagacaa gatagaggaa gagcaaaaca aaagtaagac

     5641 caccgcacag caagcggccg ctgatcttca gacctggagg aggagatatg agggacaatt

     5701 ggagaagtga attatataaa tataaagtag taaaaattga accattagga gtagcaccca

     5761 ccaaggcaaa gagaagagtg gtgcagagag aaaaaagagc agtgggaata ggagctttgt

     5821 tccttgggtt cttgggagca gcaggaagca ctatgggcgc agcgtcaatg acgctgacgg

     5881 tacaggccag acaattattg tctggtatag tgcagcagca gaacaatttg ctgagggcta

     5941 ttgaggcgca acagcatctg ttgcaactca cagtctgggg catcaagcag ctccaggcaa

     6001 gaatcctggc tgtggaaaga tacctaaagg atcaacagct cctggggatt tggggttgct

     6061 ctggaaaact catttgcacc actgctgtgc cttggaatgc tagttggagt aataaatctc

     6121 tggaacagat ttggaatcac acgacctgga tggagtggga cagagaaatt aacaattaca

     6181 caagcttaat acactcctta attgaagaat cgcaaaacca gcaagaaaag aatgaacaag

     6241 aattattgga attagataaa tgggcaagtt tgtggaattg gtttaacata acaaattggc

     6301 tgtggtatat aaaattattc ataatgatag taggaggctt ggtaggttta agaatagttt

     6361 ttgctgtact ttctatagtg aatagagtta ggcagggata ttcaccatta tcgtttcaga

     6421 cccacctccc aaccccgagg ggacccgaca ggcccgaagg aatagaagaa gaaggtggag

     6481 agagagacag agacagatcc attcgattag tgaacggatc tcgacggtat cgatcacgag

     6541 actagcctcg agcggccgcc cccttcaccg agggcctatt tcccatgatt ccttcatatt

     6601 tgcatatacg atacaaggct gttagagaga taattggaat taatttgact gtaaacacaa

     6661 agatattagt acaaaatacg tgacgtagaa agtaataatt tcttgggtag tttgcagttt

     6721 taaaattatg ttttaaaatg gactatcata tgcttaccgt aacttgaaag tatttcgatt

     6781 tcttggcttt atatatcttg tggaaaggac gaaacaccgg gcccgcaagc tgaccctgaa

     6841 gttcattcaa gagatgaact tcagggtcag cttgcttttt gaattctcga cctcgagaca

     6901 aatggcagta ttcatccaca attttaaaag aaaagggggg attggggggt acagtgcagg

     6961 ggaaagaata gtagacataa tagcaacaga catacaaact aaagaattac aaaaacaaat

     7021 tacaaaaatt caaaattttc gggtttatta cagggacagc agagatccac tttggccgcg

     7081 gctcgagggg g


No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
