pLKO.1- pLKO.1- TRC

$215.00

  • Model: PVT11104
  • 50 Units in Stock
Ask a question


Add to Cart:

pLKO.1-pLKO.1-TRC


Catalog No. PVT11104
Packing 2ug
Function /
Resistance Amp
Screen Puro
Strain Stbl3
Culture temperature 37degrees centigrade
Replicon
Copy
Promoter U6
Induction --
Forward primer U6:ATGGACTATCATATGCTTACCGTA
Reverse primer Sv40-polyA-R

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart