pLKO.1- TRC- SP6

$215.00

  • Model: PVT11105
  • 50 Units in Stock
Ask a question


Add to Cart:

pLKO.1-TRC-SP6


PVT11105     2ug

 

pLKO.1-TRC-SP6 Informaiton

Promoter: hPGK, U6, T7

Replicon: SV40 Ori, F1 Ori

Terminator: SV40 poly (A) signal, bGH poly (A) signal

Plasmid classification: virus series, lentivirus interference vector

Plasmid tagging: Stuffer

Prokaryotic resistance: Amp

Selection marker: Puro

Clone strain: Stbl3

Culture conditions: 37 C, aerobic LB

Expression host: lactation cells

Induction mode: no need to induce, transient expression.

5'sequencing primers: U6:ATGGACTATCATATGCTTACCGTA

3'sequencing primers: Sv40-polyA-R:GAAATTTGTGATGCTATTGC

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart