pLKO.5-TRC2-Puro

Catalog No. PVT11109
Packing 2ug
 

pLKO.5-TRC2-Puro Informaiton

Promoter: U6

Replicon: pUC ori, F1 ori

Plasmid classification: virus series, lentivirus interference vector

Plasmid size: 7484bp

Prokaryotic resistance: Amp

Selection marker: Puro

Clone strain: Stbl3

Culture conditions: 37 C, aerobic LB

Expression host: lactation cells

Induction mode: no need to induce, transient expression.

5'sequencing primers: U6:ATGGACTATCATATGCTTACCGTA

Primers for 3'sequencing: primers designed based on sequences

pLKO.5-TRC2-Puro Description

The MISSION TRC2 Control Vector pLKO-puro is a lentivirus plasmid vector. This vector is in the TRC2 pLKO-puro plasmid backbone, which contains the WPRE. The vector does not contain an shRNA insert and is useful as a negative control in experiments using the TRC2 MISSION shRNA library clones. This allows one to examine the effect of transfection on gene expression and interpret the knockdown effect seen with shRNA clones.