pLLP- STII- Plpp- STII

$215.00

  • Model: PVT10590
  • 50 Units in Stock
Ask a question


Add to Cart:

pLLP-STII-Plpp-STII


Catalog No. PVT10590
Packing 2ug
Function E.coli expression plasmid
Resistance Amp
Screen /
Strain DH5alpha
Culture temperature 37degrees centigrade
Replicon pBR322
Copy Low
Promoter T7
Induction IPTG
Forward primer 5GGCTTTACACTTTATGCTTC3
Reverse primer 5CCATTTTTCACTTCACAGG3

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart