pLVX- IRES- mCherry Plasmid


  • Model: PVT2307
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pLVX-IRES-mCherry,Plasmid pLVX-IRES-mCherry,pLVX-IRES-mCherry vector

pLVX-IRES-mCherry Plasmid information

Promoter: CMV IE
Replicon: pUC ori
Plasmid classification: virus series, lentiviral cloning vector
Plasmid size: 8172bp
Prokaryotic resistance: Amp
Clone strain: Stbl3
Culture conditions: 37 LB, aerobic
Expression host: mammalian cells
Induction method: no induction, transient expression
Primers for 5'sequencing: CMV-F:CGCAAATGGGCGGTAGGCGTG
Primers for 3'sequencing: primers were designed according to the sequence


pLVX-IRES-mCherry Plasmid Sequence

LOCUS       Exported                8172 bp ds-DNA     circular SYN 07-SEP-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 8172)
  TITLE     Direct Submission
  JOURNAL   Exported Wednesday, September 7, 2016 from SnapGene Viewer 3.1.4
COMMENT     Created by Clontech Laboratories Inc.
            Cat. No. 631237
FEATURES             Location/Qualifiers
     source          1..8172
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     LTR             1..635
                     /note="5' LTR"
     misc_feature    636..653
     misc_feature    685..822
                     /note="Packaging Signal"
     misc_binding    1303..1536
     misc_feature    2028..2151
                     /note="cPPT/CTS (DNA flap)"
     promoter        2185..2787
                     /note="CMV IE Promoter"
     misc_feature    2803..2840
     misc_feature    2842..3416
     CDS             3417..4127
     misc_feature    4141..4732
     LTR             4935..5571
                     /note="3' LTR"
     rep_origin      complement(6040..6713)
                     /note="pUC ori"
     CDS             complement(6858..7854)
        1 tggaagggct aattcactcc caaagaagac aagatatcct tgatctgtgg atctaccaca
       61 cacaaggcta cttccctgat tagcagaact acacaccagg gccaggggtc agatatccac
      121 tgacctttgg atggtgctac aagctagtac cagttgagcc agataaggta gaagaggcca
      181 ataaaggaga gaacaccagc ttgttacacc ctgtgagcct gcatgggatg gatgacccgg
      241 agagagaagt gttagagtgg aggtttgaca gccgcctagc atttcatcac gtggcccgag
      301 agctgcatcc ggagtacttc aagaactgct gatatcgagc ttgctacaag ggactttccg
      361 ctggggactt tccagggagg cgtggcctgg gcgggactgg ggagtggcga gccctcagat
      421 cctgcatata agcagctgct ttttgcctgt actgggtctc tctggttaga ccagatctga
      481 gcctgggagc tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct
      541 tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc
      601 agaccctttt agtcagtgtg gaaaatctct agcagtggcg cccgaacagg gacttgaaag
      661 cgaaagggaa accagaggag ctctctcgac gcaggactcg gcttgctgaa gcgcgcacgg
      721 caagaggcga ggggcggcga ctggtgagta cgccaaaaat tttgactagc ggaggctaga
      781 aggagagaga tgggtgcgag agcgtcagta ttaagcgggg gagaattaga tcgcgatggg
      841 aaaaaattcg gttaaggcca gggggaaaga aaaaatataa attaaaacat atagtatggg
      901 caagcaggga gctagaacga ttcgcagtta atcctggcct gttagaaaca tcagaaggct
      961 gtagacaaat actgggacag ctacaaccat cccttcagac aggatcagaa gaacttagat
     1021 cattatataa tacagtagca accctctatt gtgtgcatca aaggatagag ataaaagaca
     1081 ccaaggaagc tttagacaag atagaggaag agcaaaacaa aagtaagacc accgcacagc
     1141 aagcggccgg ccgctgatct tcagacctgg aggaggagat atgagggaca attggagaag
     1201 tgaattatat aaatataaag tagtaaaaat tgaaccatta ggagtagcac ccaccaaggc
     1261 aaagagaaga gtggtgcaga gagaaaaaag agcagtggga ataggagctt tgttccttgg
     1321 gttcttggga gcagcaggaa gcactatggg cgcagcgtca atgacgctga cggtacaggc
     1381 cagacaatta ttgtctggta tagtgcagca gcagaacaat ttgctgaggg ctattgaggc
     1441 gcaacagcat ctgttgcaac tcacagtctg gggcatcaag cagctccagg caagaatcct
     1501 ggctgtggaa agatacctaa aggatcaaca gctcctgggg atttggggtt gctctggaaa
     1561 actcatttgc accactgctg tgccttggaa tgctagttgg agtaataaat ctctggaaca
     1621 gatttggaat cacacgacct ggatggagtg ggacagagaa attaacaatt acacaagctt
     1681 aatacactcc ttaattgaag aatcgcaaaa ccagcaagaa aagaatgaac aagaattatt
     1741 ggaattagat aaatgggcaa gtttgtggaa ttggtttaac ataacaaatt ggctgtggta
     1801 tataaaatta ttcataatga tagtaggagg cttggtaggt ttaagaatag tttttgctgt
     1861 actttctata gtgaatagag ttaggcaggg atattcacca ttatcgtttc agacccacct
     1921 cccaaccccg aggggacccg acaggcccga aggaatagaa gaagaaggtg gagagagaga
     1981 cagagacaga tccattcgat tagtgaacgg atctcgacgg tatcgccttt aaaagaaaag
     2041 gggggattgg ggggtacagt gcaggggaaa gaatagtaga cataatagca acagacatac
     2101 aaactaaaga attacaaaaa caaattacaa aaattcaaaa ttttcgggtt tattacaggg
     2161 acagcagaga tccagtttat cgataagctt gggagttccg cgttacataa cttacggtaa
     2221 atggcccgcc tggctgaccg cccaacgacc cccgcccatt gacgtcaata atgacgtatg
     2281 ttcccatagt aacgccaata gggactttcc attgacgtca atgggtggag tatttacggt
     2341 aaactgccca cttggcagta catcaagtgt atcatatgcc aagtacgccc cctattgacg
     2401 tcaatgacgg taaatggccc gcctggcatt atgcccagta catgacctta tgggactttc
     2461 ctacttggca gtacatctac gtattagtca tcgctattac catggtgatg cggttttggc
     2521 agtacatcaa tgggcgtgga tagcggtttg actcacgggg atttccaagt ctccacccca
     2581 ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg ggactttcca aaatgtcgta
     2641 acaactccgc cccattgacg caaatgggcg gtaggcgtgt acggtgggag gtctatataa
     2701 gcagagctcg tttagtgaac cgtcagatcg cctggagacg ccatccacgc tgttttgacc
     2761 tccatagaag acaccgactc tactagagga tctatttccg gtgaattcct cgagactagt
     2821 tctagagcgg ccgcggatcc cgcccctctc cctccccccc ccctaacgtt actggccgaa
     2881 gccgcttgga ataaggccgg tgtgcgtttg tctatatgtt attttccacc atattgccgt
     2941 cttttggcaa tgtgagggcc cggaaacctg gccctgtctt cttgacgagc attcctaggg
     3001 gtctttcccc tctcgccaaa ggaatgcaag gtctgttgaa tgtcgtgaag gaagcagttc
     3061 ctctggaagc ttcttgaaga caaacaacgt ctgtagcgac cctttgcagg cagcggaacc
     3121 ccccacctgg cgacaggtgc ctctgcggcc aaaagccacg tgtataagat acacctgcaa
     3181 aggcggcaca accccagtgc cacgttgtga gttggatagt tgtggaaaga gtcaaatggc
     3241 tcacctcaag cgtattcaac aaggggctga aggatgccca gaaggtaccc cattgtatgg
     3301 gatctgatct ggggcctcgg tgcacatgct ttacatgtgt ttagtcgagg ttaaaaaacg
     3361 tctaggcccc ccgaaccacg gggacgtggt tttcctttga aaaacacgat gataatatgg
     3421 tgagcaaggg cgaggaggat aacatggcca tcatcaagga gttcatgcgc ttcaaggtgc
     3481 acatggaggg ctccgtgaac ggccacgagt tcgagatcga gggcgagggc gagggccgcc
     3541 cctacgaggg cacccagacc gccaagctga aggtgaccaa gggtggcccc ctgcccttcg
     3601 cctgggacat cctgtcccct cagttcatgt acggctccaa ggcctacgtg aagcaccccg
     3661 ccgacatccc cgactacttg aagctgtcct tccccgaggg cttcaagtgg gagcgcgtga
     3721 tgaacttcga ggacggcggc gtggtgaccg tgacccagga ctcctccctg caggacggcg
     3781 agttcatcta caaggtgaag ctgcgcggca ccaacttccc ctccgacggc cccgtaatgc
     3841 agaagaagac catgggctgg gaggcctcct ccgagcggat gtaccccgag gacggcgccc
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
