pLVX- shRNA2


  • Model: PVT2303
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT2303    2ug


pLVX-shRNA2 Information

Promoter: U6

Replicon: PUC

Terminator: SV40 poly (a) signal

Plasmid classification: virus series, lentiviral cloning vector

Plasmid size: 7880 BP

Prokaryotic resistance: amp

Clone strain: stbl3

Culture conditions: 37 degrees

Expression host: mammalian cells

5 'sequencing primer: U6: atggactatcatattgcttaccgta

3 'sequencing primers: primers were designed according to the sequence

Plasmid host: mammalian cells, lentivirus

Plasmid use: gene silencing

Fragment type: shRNA

Fragment species: empty bodies

Prokaryotic resistance: amp

Eukaryotic resistance:

Fluorescent label: Green


pLVX-shRNA2  Description

pLVX-shRNA2 is an HIV-1-based, lentiviral expression vector designed to express a small hairpin RNA (shRNA) for RNA interference (RNAi) studies. Expression of your shRNA is driven by the RNA Pol III-dependent, human U6 promoter (PU6), located just upstream of the MCS. pLVX-shRNA2 can be used as a plasmid expression vector and transfected into cells, or it can be packaged into viral particles and transduced into cells. Lentiviral particles derived from the vector allow the expression of shRNAs in virtually any cell type, including primary cells.


pLVX-shRNA2 Sequence

LOCUS       Exported                7880 bp ds-DNA     circular SYN 27-AUG-2016

DEFINITION  synthetic circular DNA




SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 7880)


  TITLE     Direct Submission

  JOURNAL   Exported Wednesday, September 7, 2016 from SnapGene Viewer 3.1.4

FEATURES             Location/Qualifiers

     source          1..7880

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     LTR             1..634

                     /note="3' LTR"

                     /note="3' long terminal repeat (LTR) from HIV-1"

     misc_feature    681..806

                     /note="HIV-1 Psi"

                     /note="packaging signal of human immunodeficiency virus 

                     type 1"

     misc_feature    1303..1536


                     /note="The Rev response element (RRE) of HIV-1 allows for 

                     Rev-dependent mRNA export from the nucleus to the 


     misc_feature    2028..2143


                     /note="central polypurine tract and central termination 

                     sequence of HIV-1 (lacking the first T)"

     promoter        2196..2436

                     /note="U6 promoter"

                     /note="RNA polymerase III promoter for human U6 snRNA"

     enhancer        2522..2825

                     /note="CMV enhancer"

                     /note="human cytomegalovirus immediate early enhancer"

     promoter        2826..3029

                     /note="CMV promoter"

                     /note="human cytomegalovirus (CMV) immediate early 


     CDS             3074..3769


                     /product="Zoanthus green fluorescent protein"


                     /note="mammalian codon-optimized"






     misc_feature    3802..4390


                     /note="woodchuck hepatitis virus posttranscriptional 

                     regulatory element"

     CDS             complement(4273..4284)


                     /product="Factor Xa recognition and cleavage site"

                     /note="Factor Xa site"


     LTR             4597..5230

                     /note="3' LTR"

                     /note="3' long terminal repeat (LTR) from HIV-1"

     primer_bind     complement(5358..5374)

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     protein_bind    5382..5398

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     promoter        complement(5406..5436)

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    5451..5472

                     /bound_moiety="E. coli catabolite activator protein"

                     /note="CAP binding site"

                     /note="CAP binding activates transcription in the presence 

                     of cAMP."

     rep_origin      complement(5760..6348)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(6519..7379)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     promoter        complement(7380..7484)


                     /note="AmpR promoter"

     polyA_signal    7532..7666

                     /note="SV40 poly(A) signal"

                     /note="SV40 polyadenylation signal"


        1 tggaagggct aattcactcc caaagaagac aagatatcct tgatctgtgg atctaccaca

       61 cacaaggcta cttccctgat tagcagaact acacaccagg gccaggggtc agatatccac

      121 tgacctttgg atggtgctac aagctagtac cagttgagcc agataaggta gaagaggcca

      181 ataaaggaga gaacaccagc ttgttacacc ctgtgagcct gcatgggatg gatgacccgg

      241 agagagaagt gttagagtgg aggtttgaca gccgcctagc atttcatcac gtggcccgag

      301 agctgcatcc ggagtacttc aagaactgct gatatcgagc ttgctacaag ggactttccg

      361 ctggggactt tccagggagg cgtggcctgg gcgggactgg ggagtggcga gccctcagat

      421 cctgcatata agcagctgct ttttgcctgt actgggtctc tctggttaga ccagatctga

      481 gcctgggagc tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct

      541 tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc

      601 agaccctttt agtcagtgtg gaaaatctct agcagtggcg cccgaacagg gacttgaaag

      661 cgaaagggaa accagaggag ctctctcgac gcaggactcg gcttgctgaa gcgcgcacgg

      721 caagaggcga ggggcggcga ctggtgagta cgccaaaaat tttgactagc ggaggctaga

      781 aggagagaga tgggtgcgag agcgtcagta ttaagcgggg gagaattaga tcgcgatggg

      841 aaaaaattcg gttaaggcca gggggaaaga aaaaatataa attaaaacat atagtatggg

      901 caagcaggga gctagaacga ttcgcagtta atcctggcct gttagaaaca tcagaaggct

      961 gtagacaaat actgggacag ctacaaccat cccttcagac aggatcagaa gaacttagat

     1021 cattatataa tacagtagca accctctatt gtgtgcatca aaggatagag ataaaagaca

     1081 ccaaggaagc tttagacaag atagaggaag agcaaaacaa aagtaagacc accgcacagc

     1141 aagcggccgg ccgctgatct tcagacctgg aggaggagat atgagggaca attggagaag

     1201 tgaattatat aaatataaag tagtaaaaat tgaaccatta ggagtagcac ccaccaaggc

     1261 aaagagaaga gtggtgcaga gagaaaaaag agcagtggga ataggagctt tgttccttgg

     1321 gttcttggga gcagcaggaa gcactatggg cgcagcgtca atgacgctga cggtacaggc

     1381 cagacaatta ttgtctggta tagtgcagca gcagaacaat ttgctgaggg ctattgaggc

     1441 gcaacagcat ctgttgcaac tcacagtctg gggcatcaag cagctccagg caagaatcct

     1501 ggctgtggaa agatacctaa aggatcaaca gctcctgggg atttggggtt gctctggaaa

     1561 actcatttgc accactgctg tgccttggaa tgctagttgg agtaataaat ctctggaaca

     1621 gatttggaat cacacgacct ggatggagtg ggacagagaa attaacaatt acacaagctt

     1681 aatacactcc ttaattgaag aatcgcaaaa ccagcaagaa aagaatgaac aagaattatt

     1741 ggaattagat aaatgggcaa gtttgtggaa ttggtttaac ataacaaatt ggctgtggta

     1801 tataaaatta ttcataatga tagtaggagg cttggtaggt ttaagaatag tttttgctgt

     1861 actttctata gtgaatagag ttaggcaggg atattcacca ttatcgtttc agacccacct

     1921 cccaaccccg aggggacccg acaggcccga aggaatagaa gaagaaggtg gagagagaga

     1981 cagagacaga tccattcgat tagtgaacgg atctcgacgg tatcgccttt aaaagaaaag

     2041 gggggattgg ggggtacagt gcaggggaaa gaatagtaga cataatagca acagacatac

     2101 aaactaaaga attacaaaaa caaattacaa aaattcaaaa ttttcgggtt tattacaggg

     2161 acagcagaga tccagtttat cgatctgggc aggaagaggg cctatttccc atgattcctt

     2221 catatttgca tatacgatac aaggctgtta gagagataat tagaattaat ttgactgtaa

     2281 acacaaagat attagtacaa aatacgtgac gtagaaagta ataatttctt gggtagtttg

     2341 cagttttaaa attatgtttt aaaatggact atcatatgct taccgtaact tgaaagtatt

     2401 tcgatttctt ggctttatat atcttgtgga aaggacgagg atccggacaa gcttcgaatt

     2461 ctagttatta atagtaatca attacggggt cattagttca tagcccatat atggagttcc

     2521 gcgttacata acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat

     2581 tgacgtcaat aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc

     2641 aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc

     2701 caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt

     2761 acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta

     2821 ccatggtgat gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg

     2881 gatttccaag tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac

     2941 gggactttcc aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg

     3001 tacggtggga ggtctatata agcagagctg gtttagtgaa ccgtcagatc cgctagcgct

     3061 accggtcgcc accatggccc agtccaagca cggcctgacc aaggagatga ccatgaagta

     3121 ccgcatggag ggctgcgtgg acggccacaa gttcgtgatc accggcgagg gcatcggcta

     3181 ccccttcaag ggcaagcagg ccatcaacct gtgcgtggtg gagggcggcc ccttgccctt

     3241 cgccgaggac atcttgtccg ccgccttcat gtacggcaac cgcgtgttca ccgagtaccc

     3301 ccaggacatc gtcgactact tcaagaactc ctgccccgcc ggctacacct gggaccgctc

     3361 cttcctgttc gaggacggcg ccgtgtgcat ctgcaacgcc gacatcaccg tgagcgtgga

     3421 ggagaactgc atgtaccacg agtccaagtt ctacggcgtg aacttccccg ccgacggccc

     3481 cgtgatgaag aagatgaccg acaactggga gccctcctgc gagaagatca tccccgtgcc

     3541 caagcagggc atcttgaagg gcgacgtgag catgtacctg ctgctgaagg acggtggccg

     3601 cttgcgctgc cagttcgaca ccgtgtacaa ggccaagtcc gtgccccgca agatgcccga

     3661 ctggcacttc atccagcaca agctgacccg cgaggaccgc agcgacgcca agaaccagaa

     3721 gtggcacctg accgagcacg ccatcgcctc cggctccgcc ttgccctaac tcgagtctag

     3781 agggcccgac gcgtctggaa caatcaacct ctggattaca aaatttgtga aagattgact

     3841 ggtattctta actatgttgc tccttttacg ctatgtggat acgctgcttt aatgcctttg

     3901 tatcatgcta ttgcttcccg tatggctttc attttctcct ccttgtataa atcctggttg

     3961 ctgtctcttt atgaggagtt gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg

     4021 tttgctgacg caacccccac tggttggggc attgccacca cctgtcagct cctttccggg

     4081 actttcgctt tccccctccc tattgccacg gcggaactca tcgccgcctg ccttgcccgc

     4141 tgctggacag gggctcggct gttgggcact gacaattccg tggtgttgtc ggggaagctg

     4201 acgtcctttc catggctgct cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc

     4261 tgctacgtcc cttcggccct caatccagcg gaccttcctt cccgcggcct gctgccggct

     4321 ctgcggcctc ttccgcgtct tcgccttcgc cctcagacga gtcggatctc cctttgggcc

     4381 gcctccccgc ctggaattaa ttctgcagtc gagacctaga aaaacatgga gcaatcacaa

     4441 gtagcaatac agcagctacc aatgctgatt gtgcctggct agaagcacaa gaggaggagg

     4501 aggtgggttt tccagtcaca cctcaggtac ctttaagacc aatgacttac aaggcagctg

     4561 tagatcttag ccacttttta aaagaaaaga ggggactgga agggctaatt cactcccaac

     4621 gaagacaaga tatccttgat ctgtggatct accacacaca aggctacttc cctgattagc

     4681 agaactacac accagggcca ggggtcagat atccactgac ctttggatgg tgctacaagc

     4741 tagtaccagt tgagccagat aaggtagaag aggccaataa aggagagaac accagcttgt

     4801 tacaccctgt gagcctgcat gggatggatg acccggagag agaagtgtta gagtggaggt

     4861 ttgacagccg cctagcattt catcacgtgg cccgagagct gcatccggag tacttcaaga

     4921 actgctgata tcgagcttgc tacaagggac tttccgctgg ggactttcca gggaggcgtg

     4981 gcctgggcgg gactggggag tggcgagccc tcagatcctg catataagca gctgcttttt

     5041 gcctgtactg ggtctctctg gttagaccag atctgagcct gggagctctc tggctaacta

     5101 gggaacccac tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc

     5161 cgtctgttgt gtgactctgg taactagaga tccctcagac ccttttagtc agtgtggaaa

     5221 atctctagca gtagtagttc atgtcatctt attattcagt atttataact tgcaaagaaa

     5281 tgaatatcag agagtgagag gccttgacat tgctagcgtt taccgtcgac ctctagctag

     5341 agcttggcgt aatcatggtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt

     5401 ccacacaaca tacgagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagc

     5461 taactcacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc

     5521 cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct

     5581 tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca

     5641 gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac

     5701 atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt

     5761 ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg

     5821 cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc

     5881 tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc

     5941 gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc

     6001 aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac

     6061 tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt

     6121 aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct

     6181 aactacggct acactagaag aacagtattt ggtatctgcg ctctgctgaa gccagttacc

     6241 ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt

     6301 ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg

     6361 atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc

     6421 atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa

     6481 tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag

     6541 gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg

     6601 tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga

     6661 gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag

     6721 cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa

     6781 gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc

     6841 atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca

     6901 aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg

     6961 atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat

     7021 aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc

     7081 aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg

     7141 gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg

     7201 gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt

     7261 gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca

     7321 ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata

     7381 ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac

     7441 atatttgaat gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa

     7501 gtgccacctg acgtcgacgg atcgggagat caacttgttt attgcagctt ataatggtta

     7561 caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag

     7621 ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc tggatcaact ggataactca

     7681 agctaaccaa aatcatccca aacttcccac cccataccct attaccactg ccaattacct

     7741 gtggtttcat ttactctaaa cctgtgattc ctctgaatta ttttcatttt aaagaaattg

     7801 tatttgttaa atatgtacta caaacttagt agtttttaaa gaaattgtat ttgttaaata

     7861 tgtactacaa acttagtagt



Product is for research use only!


Search name

pLVX-shRNA2(non-Empty backbone),Plasmid pLVX-shRNA2(non-Empty backbone),pLVX-shRNA2(non-Empty backbone) vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
