pLVX-PAmCherry-N1

$280.00

  • Model: PVTY00892
  • 20 Units in Stock
Ask a question


Add to Cart:

pLVX-PAmCherry-N1

PVTY00892  2ug

pLVX-PAmCherry-N1 Description

Plasmid type: Lentiviral vector Copy Number: High copy Promoter: CMV Cloning Method: Multiple cloning sites,restriction endonuclease Size: 8777 bp 5' Sequencing primers and sequences: CMV-F: CGCAAATGGGCGGTAGGCGTG(Invitrogen) Tags: C-PAmCherry Resistance(s): Ampicillin (Amp) Selectable markers: Puromycin? Note: The vector can express C-terminal PAmCherry fluorescent protein.

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart