

  • Model: PVT11294
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT11294
Packing 2ug


pMA0911 Informaiton

Replicator: pUC ori, F1 ori

Plasmid classification: Bacillus subtilis plasmid, hay free plasmid, plasmid in hay.

Plasmid size: 7215bp

Prokaryotic resistance: ampicillin Amp

5'sequencing primers: PMA0911F:gcgaaaatgcctcacatttgtgcc.

3'sequencing primers: PMA0911R:cgggatctcagatctggtacgtacc


pMA0911 Description

PMA0911 is an intracellular expression plasmid of Bacillus subtilis


pMA0911 Sequence

LOCUS       Exported                7215 bp ds-DNA     circular SYN 10-AUG-2017

DEFINITION  synthetic circular DNA

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 7215)

  TITLE     Direct Submission

  JOURNAL   Exported Sep 15, 2017

FEATURES             Location/Qualifiers

     source          1..7215

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     CDS             4..113


                     /label=Lip A SP


     primer_bind     complement(185..209)


     rep_origin      537..992


                     /label=f1 ori

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"

     promoter        1018..1122


                     /label=AmpR promoter

     CDS             1123..1419





     CDS             1466..1984







     rep_origin      2155..2746



                     /note="high-copy-number colE1/pMB1/pBR322/pUC origin of 


     promoter        complement(3516..3618)

                     /label=cat promoter

                     /note="promoter of the E. coli cat gene"

     CDS             4157..5161









     CDS             5321..6091


                     /label=Kana Neo






     CDS             6314..6712






     primer_bind     7172..7195



        1 catatcctca tatggtcagc atccgccgca gcttcgaagc gtatgtcgat gacatgaata

       61 tcattactgt tctgattcct gctgaacaaa aggaaatcat gacaccgccg gaattcgtcg

      121 acaagcttgg taccagatct gatatccctg cagggatcct ctagagtcga gctcaagcta

      181 gcttggtacg taccagatct gagatcccgg gttctagagg tcgaaattca cctcgaaagc

      241 aagctgataa accgatacaa ttaaaggctc cttttggagc cttttttttt ggagattttc

      301 aacgtgaaaa aattattatt cgcaattcca agctaattca cctcgaaagc aagctgataa

      361 accgatacaa ttaaaggctc cttttggagc cttttttttt ggagattttc aacgtgaaaa

      421 aattattatt cgcaattcca agctctgcct cgcgcgtttc ggtgatgacg gtgaaaacct

      481 ctgacacatg cagctcccgg agacggtcac agcttgtctg taagcggatg cagatcacgc

      541 gccctgtagc ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg tgaccgctac

      601 acttgccagc gccctagcgc ccgctccttt cgctttcttc ccttcctttc tcgccacgtt

      661 cgccggcttt ccccgtcaag ctctaaatcg ggggctccct ttagggttcc gatttagtgc

      721 tttacggcac ctcgacccca aaaaacttga ttagggtgat ggttcacgta gtgggccatc

      781 gccctgatag acggtttttc gccctttgac gttggagtcc acgttcttta atagtggact

      841 cttgttccaa actggaacaa cactcaaccc tatctcggtc tattcttttg atttataagg

      901 gattttgccg atttcggcct attggttaaa aaatgagctg atttaacaaa aatttaacgc

      961 gaattttaac aaaatattaa cgcttacaat ttaggtggca cttttcgggg aaatgtgcgc

     1021 ggaaccccta tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa

     1081 taaccctgat aaatgcttca ataatattga aaaaggaaga gtatgagtat tcaacatttc

     1141 cgtgtcgccc ttattccctt ttttgcggca ttttgccttc ctgtttttgc tcacccagaa

     1201 acgctggtga aagtaaaaga tgctgaagat cagttgggtg cacgagtggg ttacatcgac

     1261 tgcaatctca acagcggtaa gatccttgag agttttcgcc ccgaagaacg ttttccaatg

     1321 atgagcactt ttaaagttct gctatgtggc gcggtattat cccgtattga cgccgggcaa

     1381 gagcaactcg gtcgccgcat acactattct gcagaatgac ttggttgagt actcaccagt

     1441 cacagaaaag catcttacgg atggcatgac agtaagagaa ttatgcagtg ctgccataac

     1501 catgagtgat aacactgcgg ccaacttact tctgacaacg atcggaggac cgaaggagct

     1561 aaccgctttt ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt gggaaccgga

     1621 gctgaatgaa gccataccaa acgacgagcg tgacaccacg atgcctgtag caatggcaac

     1681 aacgttgcgc aaactattaa ctggcgaact acttactcta gcttcccggc aacaattaat

     1741 agactggatg gaggcggata aagttgcagg accacttctg cgctcggccc ttccggctgg

     1801 ctggtttatt gctgataaat ctggagccgg tgagcgtggg tctcgcggta tcattgcagc

     1861 actggggcca gatggtaagc cctcccgtat cgtagttatc tacacgacgg ggagtcaggc

     1921 aactatggat gaacgaaata gacagatcgc tgagataggt gcctcactga ttaagcattg

     1981 gtaactgtca gaccaagttt actcatatat actttagatt gatttaaaac ttcattttta

     2041 atttaaaagg atctaggtga agatcctttt tgataatctc atgaccaaaa tcccttaacg

     2101 tgagttttcg ttccactgag cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga

     2161 tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt

     2221 ggtttgtttg ccggatcaag agctaccaac tctttttccg aaggtaactg gcttcagcag

     2281 agcgcagata ccaaatactg tccttctagt gtagccgtag ttaggccacc acttcaagaa

     2341 ctctgtagca ccgcctacat acctcgctct gctaatcctg ttaccagtgg ctgctgccag

     2401 tggcgataag tcgtgtctta ccgggttgga ctcaagacga tagttaccgg ataaggcgca

     2461 gcggtcgggc tgaacggggg gttcgtgcac acagcccagc ttggagcgaa cgacctacac

     2521 cgaagtactg agatacctac agcgtgagct atgagaaagc gccacgcttc ccgaagggag

     2581 aaaggcggac aggtatccgg taagcggcag ggtcggaaca ggagagcgca cgagggagct

     2641 tccaggggga aacgcctggt atctttatag tcctgtcggg tttcgccacc tctgacttga

     2701 gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta tggaaaaacg ccagcaacgc

     2761 ggccttttta cggttcctgg ccttttgctg gccttttgct cacatgttct ttcctgcgtt

     2821 atcccctgat tctgtggata accgtattac cgcctttgag tgagctgata ccgctcgccg

     2881 cagccgaacg accgagcgca gcgagtcagt gagcgaggaa gcggaagagc gcccaatacg

     2941 caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctggcacg acaggtttcc

     3001 cgactggaaa gcgggcagtg agcgcaacgc aattaatgtg agttagctca ctcattaggc

     3061 accccaggct ttacacttta tgcttccggc atattctcaa taaacccttt agggaaatag

     3121 gccaggtttt caccgtaaca cgccacatct tgcgaatata tgtgtagaaa ctgccggaaa

     3181 tcgtcgtggt attcactcca gagcgatgaa aacgtttcag tttgctcatg gaaaacggtg

     3241 taacaagggt gaacactatc ccatatcacc agctcaccgt ctttcattgc catacgaaat

     3301 tccggatgag cattcatcag gcgggcaaga atgtgaataa aggccggata aaacttgtgc

     3361 ttatttttct ttacggtctt taaaaaggcc gtaatatcca gctaaacggt ctggttatag

     3421 gtacattgag caactgactg aaatgcctca aaatgttctt tacgatgcca ttgggatata

     3481 tcaacggtgg tatatccagt gatttttttc tccattttag cttccttagc tcctgaaaat

     3541 ctcgataact caaaaaatac gcccggtagt gatcttattt cattatggtg aaagttggaa

     3601 cctcttacgt gccgatcaac gtctcatttt cgccaaaagt tggcccaggg cttcccggta

     3661 tcaacaggga caccaggatt tatttattct gcgaagtgat cttccgtcac aggtatttat

     3721 tcgaagacga aagggcatcg cgcgcgggaa attcccggga gagctcgata tcgcatgcgg

     3781 tacctctaga agaagcttgg agacaaggta aaggataaaa cagcacaatt ccaagaaaaa

     3841 cacgatttag aacctaaaaa gaacgaattt gaactaactc ataaccgaga ggtaaaaaaa

     3901 gaacgaagtc gagatcaggg aatgagttta taaaataaaa aaagcacctg aaaaggtgtc

     3961 tttttttgat ggttttgaac ttgttctttc ttatcttgat acatatagaa ataacgtcat

     4021 ttttatttta gttgctgaaa ggtgcgttga agtgttggta tgtatgtgtt ttaaagtatt

     4081 gaaaaccctt aaaattggtt gcacagaaaa accccatctg ttaaagttat aagtgactaa

     4141 acaaataact aaatagatgg gggtttcttt taatattatg tgtcctaata gtagcattta

     4201 ttcagatgaa aaatcaaggg ttttagtgga caagacaaaa agtggaaaag tgagaccatg

     4261 gagagaaaag aaaatcgcta atgttgatta ctttgaactt ctgcatattc ttgaatttaa

     4321 aaaggctgaa agagtaaaag attgtgctga aatattagag tataaacaaa atcgtgaaac

     4381 aggcgaaaga aagttgtatc gagtgtggtt ttgtaaatcc aggctttgtc caatgtgcaa

     4441 ctggaggaga gcaatgaaac atggcattca gtcacaaaag gttgttgctg aagttattaa

     4501 acaaaagcca acagttcgtt ggttgtttct cacattaaca gttaaaaatg tttatgatgg

     4561 cgaagaatta aataagagtt tgtcagatat ggctcaagga tttcgccgaa tgatgcaata

     4621 taaaaaaatt aataaaaatc ttgttggttt tatgcgtgca acggaagtga caataaataa

     4681 taaagataat tcttataatc agcacatgca tgtattggta tgtgtggaac caacttattt

     4741 taagaataca gaaaactacg tgaatcaaaa acaatggatt caattttgga aaaaggcaat

     4801 gaaattagac tatgatccaa atgtaaaagt tcaaatgatt cgaccgaaaa ataaatataa

     4861 atcggatata caatcggcaa ttgacgaaac tgcaaaatat cctgtaaagg atacggattt

     4921 tatgaccgat gatgaagaaa agaatttgaa acgtttgtct gatttggagg aaggtttaca

     4981 ccgtaaaagg ttaatctcct atggtggttt gttaaaagaa atacataaaa aattaaacct

     5041 tgatgacaca gaagaaggcg atttgattca tacagatgat gacgaaaaag ccgatgaaga

     5101 tggattttct attattgcaa tgtggaattg ggaacggaaa aattatttta ttaaagagta

     5161 gttcaacaaa cgggccagtt tgttgaagat tagatgctat aattgttatt aaaaggattg

     5221 aaggatgctt aggaagacga gttattaata gctgaataag aacggtgctc tccaaatatt

     5281 cttatttaga aaagcaaatc taaaattatc tgaaaaggga atgagaatag tgaatggacc

     5341 aataataatg actagagaag aaagaatgaa gattgttcat gaaattaagg aacgaatatt

     5401 ggataaatat ggggatgatg ttaaggctat tggtgtttat ggctctcttg gtcgtcagac

     5461 tgatgggccc tattcggata ttgagatgat gtgtgtcatg tcaacagagg aagcagagtt

     5521 cagccatgaa tggacaaccg gtgagtggaa ggtggaagtg aattttgata gcgaagagat

     5581 tctactagat tatgcatctc aggtggaatc agattggccg cttacacatg gtcaattttt

     5641 ctctattttg ccgatttatg attcaggtgg atacttagag aaagtgtatc aaactgctaa

     5701 atcggtagaa gcccaaacgt tccacgatgc gatttgtgcc cttatcgtag aagagctgtt

     5761 tgaatatgca ggcaaatggc gtaatattcg tgtgcaagga ccgacaacat ttctaccatc

     5821 cttgactgta caggtagcaa tggcaggtgc catgttgatt ggtctgcatc atcgcatctg

     5881 ttatacgacg agcgcttcgg tcttaactga agcagttaag caatcagatc ttccttcagg

     5941 ttatgaccat ctgtgccagt tcgtaatgtc tggtcaactt tccgactctg agaaacttct

     6001 ggaatcgcta gagaatttct ggaatgggat tcaggagtgg acagaacgac acggatatat

     6061 agtggatgtg tcaaaacgca taccattttg aacgatgacc tctaataatt gttaatcatg

     6121 ttggttacgt atttattaac ttctcctagt attagtaatt atcatggctg tcatggcgca

     6181 ttaacggaat aaagggtgtg cttaaatcgg gccattttgc gtaataagaa aaaggattaa

     6241 ttatgagcga attgaattaa taataaggta atagatttac attagaaaat gaaaggggat

     6301 tttatgcgtg agaatgttac agtctatccc ggcattgcca gtcggggata ttaaaaagag

     6361 tataggtttt tattgcgata aactaggttt cactttggtt caccatgaag atggattcgc

     6421 agttctaatg tgtaatgagg ttcggattca tctatgggag gcaagtgatg aaggctggcg

     6481 ctctcgtagt aatgattcac cggtttgtac aggtgcggag tcgtttattg ctggtactgc

     6541 tagttgccgc attgaagtag agggaattga tgaattatat caacatatta agcctttggg

     6601 cattttgcac cccaatacat cattaaaaga tcagtggtgg gatgaacgag actttgcagt

     6661 aattgatccc gacaacaatt tgattagctt ttttcaacaa ataaaaagct aaaatctatt

     6721 attaatctgt tcagcaatcg ggcgcgattg ctgaataaaa gatacgagag acctctcttg

     6781 tatctttttt attttgagtg gttttgtccg ttacactaga aaaccgaaag acaataaaaa

     6841 ttttattctt gctgagtctg gctttcggta agctagacaa aacggacaaa ataaaaattg

     6901 gcaagggttt aaaggtggag attttttgag tgatcttctc aaaaaatact acctgtccct

     6961 tgctgatttt taaacgagca cgagagcaaa accccccttt gctgaggtgg cagagggcag

     7021 gtttttttgt ttcttttttc tcgtaaaaaa aagaaaggtc ttaaaggttt tatggttttg

     7081 gtcggcactg ccgacagcct cgcagagcac acactttatg aatataaagt atagtgtgtt

     7141 atactttact tggaagtggt tgccggaaag agcgaaaatg cctcacattt gtgccaccta

     7201 aaaaggagcg attta


Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
