pmCherry- EGFP- LC3b


  • Model: PVT10398
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT10398
Packing 2ug


pmCherry-EGFP-LC3b Information
Function ORF expression plasmid

Promoter: CMV

Replicator: pUC ori, F1 ori, SV40 ori

Terminator: SV40 poly (A) signal

Plasmid classification: mammalian cells, autophagic expression vectors

Plasmid size: 5833bp

Prokaryotic resistance: kanamycin Kan

Screening markers: Mycophenolate G418

Cloned strain: Escherichia coli DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: mammalian cells

Induction mode: no induction, instantaneous expression


3'sequencing primers: Sv40-polyA-R:GAAATTTGTGATGCTATTGC


pmCherry-EGFP-LC3b Description

PmCherry-EGFP-LC3b is a double fluorescent reporter plasmid for human mammalian cell autophagy.


pmCherry-EGFP-LC3b Reference

Foot-and-mouth disease virus capsid protein VP2 activates the cellular EIF2S1-ATF4 pathway and induces autophagy via HSPB1.


pmCherry-EGFP-LC3b Sequence

LOCUS       Exported                5833 bp ds-DNA     circular SYN 12-MAY-2016
FEATURES             Location/Qualifiers
     source          1..5833
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        61..364
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        365..568
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early 
     CDS             604..1311
                     /product="monomeric derivative of DsRed fluorescent protein
                     (Shaner et al., 2004)"
                     /note="mammalian codon-optimized"
     CDS             1333..2049
                     /product="enhanced GFP"
                     /note="mammalian codon-optimized"
     misc_feature    2083..2457
     polyA_signal    2621..2742
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(2749..3204)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     promoter        3231..3335
                     /note="AmpR promoter"
     promoter        3337..3694
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      3545..3680
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     CDS             3729..4523
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="confers resistance to neomycin, kanamycin, and G418 
     polyA_signal    4755..4802
                     /note="HSV TK poly(A) signal"
                     /note="herpes simplex virus thymidine kinase 
                     polyadenylation signal (Cole and Stacy, 1985)"
     rep_origin      5131..5719
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg
       61 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt
      121 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca
      181 atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc
      241 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta
      301 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac
      361 catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg
      421 atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg
      481 ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt
      541 acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagccgcc
      601 accatggtga gcaagggcga ggaggataac atggccatca tcaaggagtt catgcgcttc
      661 aaggtgcaca tggagggctc cgtgaacggc cacgagttcg agatcgaggg cgagggcgag
      721 ggccgcccct acgagggcac ccagaccgcc aagctgaagg tgaccaaggg tggccccctg
      781 cccttcgcct gggacatcct gtcccctcag ttcatgtacg gctccaaggc ctacgtgaag
      841 caccccgccg acatccccga ctacttgaag ctgtccttcc ccgagggctt caagtgggag
      901 cgcgtgatga acttcgagga cggcggcgtg gtgaccgtga cccaggactc ctccctgcag
      961 gacggcgagt tcatctacaa ggtgaagctg cgcggcacca acttcccctc cgacggcccc
     1021 gtaatgcaga agaagaccat gggctgggag gcctcctccg agcggatgta ccccgaggac
     1081 ggcgccctga agggcgagat caagcagagg ctgaagctga aggacggcgg ccactacgac
     1141 gctgaggtca agaccaccta caaggccaag aagcccgtgc agctgcccgg cgcctacaac
     1201 gtcaacatca agttggacat cacctcccac aacgaggact acaccatcgt ggaacagtac
     1261 gaacgcgccg agggccgcca ctccaccggc ggcatggacg agctgtacaa gtccggactc
     1321 agatctcgag gcatggtgag caagggcgag gagctgttca ccggggtggt gcccatcctg
     1381 gtcgagctgg acggcgacgt aaacggccac aagttcagcg tgtccggcga gggcgagggc
     1441 gatgccacct acggcaagct gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg
     1501 ccctggccca ccctcgtgac caccctgacc tacggcgtgc agtgcttcag ccgctacccc
     1561 gaccacatga agcagcacga cttcttcaag tccgccatgc ccgaaggcta cgtccaggag
     1621 cgcaccatct tcttcaagga cgacggcaac tacaagaccc gcgccgaggt gaagttcgag
     1681 ggcgacaccc tggtgaaccg catcgagctg aagggcatcg acttcaagga ggacggcaac
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
