pMo130-TelR

$260.00

  • Model: PVT14132
  • 20 Units in Stock
Ask a question


Add to Cart:

pMo130-TelR

PVT14132    2ug
 

 

pMo130-TelR Search name

pMo130-TelR,pMo130-TelR vector,pMo130-TelR plasmid,pMo130-TelR map

 

 

pMo130-TelR Information

Bacterial Resistance(s):   Kan

Screening: TelR 
Growth Strain(s): DH5 alpha
Growth Condition: LB/37 Centigrade

 

pMo130-TelR Sequence

ATGAATGCCACAAACACCGATGTTTTCGCCCAGGTAGGCGGCCTGGAGGCCCGAGGCGCGAAGATGAAGAAGCGGGGCAC
CCGCTTCCTCATCGCGGCGCTGGCAGTCCTTGCCATTGCCGGGATCGGGGCAGTAACGGGATGGGCGATCAGCCCGAGCG
CGACGCCCGGAAGCATTGACGTGCCGCAGGTGCTGGCATCGACATTCAGCGACCAGGTGCCGGGCAGTGAGGGCGGCGGC
CTGGGTGGCGGCCTGCCCTTCACTTCGGCCGTCGGGGCATTCACGGACTTCATGGCGGGGCCGGCAATTTTTACCTTGGG
CATTCTTGGCATAGTGGTCGCGGGTGCCGTGCTCGTGTTCGGGGGTGAGTTCTGCGGGTTCGTGCGATCCGTCTGCATGA
TGGTGATAGCCGTCAGCATGATTTTCGTGTCGTCGAACTTGGTGAAGGGCATTCTCGGCGGCGATCACGACGCCGGCCCT
GCGGAGCCTTCGCCGCGTGCGCGATTCATGGCGGCCGTGGAGGCCAAGGATTTCGCGCGAGTGCAAGAGCTGATCGAGGC
GCGTGGAGCCAAGTCGGCGGCTGATTATGTCCTTGCGCAGCTCGCCGTGGCCGAAGGTCTGGACCGCAAGCCTGGTGCGC
GCGTCGTGGTCGGGAAAGCGGCGGGCAGCATGGCAATGCCGCCTGCGGCGCTGGGTTTTACGCCAAGGGGAGAAGCGGCA
TACGCCATCGAGCGGTCAGCCTATGGTGAGCCGAGGTCCAGCATTGCGAAGCAGTACCAGCAGGAATGGAACCGGAAGGC
GGCGACCTGGTGGGCGATGGCCGGTGTGGCCGGCATCATCGGCGCGATCCTGGCGGCGGCGGCAACCGGCTTTGTTGGGC
TGGCAGTGTCGATCCGCAACCGAGTGAAGCGCGTGCGCGACCTGTTGGTGATGGAGCCGGGTGCAGAGCCATAAGGGATC
GATCCCCCTCAAGTCAAAAGCCTCCGGTCGGAGGCTTTTGACTTTCTGCTCGAGGAGCTAATTCCATTGAGTAAGTTTTT
AAGCACATCAGCTTCAAAAGCGCTCTGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGTACTTCAAGATC
CCCAATTCGAGCTCGGTACCCGGGAAGATCTGGCTAGCGGGGCCCTGATATCAGCTCACTCAAAGGCGGTAATACGGTTA
TCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGC
GTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACC
CGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACC
GGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTA
GGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTC
TTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTA
GGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCT
GAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTG
TTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAG
TGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAA
ATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTATTAATTAATCCTCAATCGCTCTTCGT
TCGTCTGGAAGGCAGTACACCTTGATAGGTGGGCTGCCCTTCCTGGTTGGCTTGGTTTCATCAGCCATCCGCTTGCCCTC
ATCTGTTACGCCGGCGGTAGCCGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAG
TGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGGCTGACGCCGTTGGATACACCAAGGAAAG
TCTACACGAACCCTTTGGCAAAATCCTGTATATCGTGCGAAAAAGGATGGATATACCGAAAAAATCGCTATAATGACCCC
GAAGCAGGGTTATGCAGCGGAAAAGCGCTGCTTCCCTGCTGTTTTGTGGAATATCTACCGACTGGAAACAGGCAAATGCA
GGAAATTACTGAACTGAGGGGACAGGCGAGAGACGATGCCAAAGAGCTACACCGACGAGCTGGCCGAGTGGGTTGAATCC
CGCGCGGCCAAGAAGCGCCGGCGTGATGAGGCTGCGGTTGCGTTCCTCCGCGGCAGATGTCTGCCTGTTCATCCGCGTCC
AGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGTTT
GGTCACTGATGCCTCCGTGTAAGGGGGATTTCTGTTCATGGGGGTAATGATACCGATGAAACGAGAGAGGATGCTCACGA
TACGGGTTACTGATGATGAACATGCCCGGTTACTGGAACGTTGTGAGGGTAAACAACTGGCGGTATGGATGCGGCGGGAC
CAGAGAAAAATCACTCAGGGTCAATGCCAGCGCTTCGTTAATACAGATGTAGGTGTTCCACAGGGTAGCCAGCAGCATCC
TGCGATGCAGATCCGGAACATAATGGTGCAGGGCGCTGACTTCCGCGTTTCCAGACTTTACGAAACACGGAAACCGAAGA
CCATTCATGTTGTTGCTCAGGTCGCAGACGTTTTGCAGCAGCAGTCGCTTCACGTTCGCTCGCGTATCGGTGATTCATTC
TGCTAACCAGTAAGGCAACCCCGCCAGCCTAGCCGGGTCCTCAACGACAGGAGCACGATCATGCGCACCCGTGGGGCCGC
CATGCCGGCGATAATGGCCTGCTTCTCGCCGAAACGTTTGGTGGCGGGACCAGTGACGAAGGCTTGAGCGAGGGCGTGCA
AGATTCCGAATACCGCAAGCGACAGGCCGATCATCGTCGCGCTCCAGCGAAAGCGGTCCTCGCCGAAAATGACCCAGAGC
GCTGCCGGCACCTGTCCTACGAGTTGCATGATAAAGAAGACAGTCATAAGTGCGGCGACGATAGTCATGCCCCGCGCCCA
CCGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGGTGCCTAATGAGTGAGCTAACTTACAT
TAATTGCGGAATTCTCAGATTAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGAAAGCTACTATTAT
TTGTTAACTGTTAATTGTCCTTGTTCAAGGATGCTGTCTTTGACAACAGATGTTTTCTTGCCTTTGATGTTCAGCAGGAA
GCTCGGCGCAAACGTTGATTGTTTGTCTGCGTAGAATCCTCTGTTTGTCATATAGCTTGTAATCACGACATTGTTTCCTT
TCGCTTGAGGTACAGCGAAGTGTGAGTAAGTAAAGGTTACATCGTTAGGATCAAGATCCATTTTTAACACAAGGCCAGTT
TTGTTCAGCGGCTTGTATGGGCCAGTTAAAGAATTAGAAACATAACCAAGCATGTAAATATCGTTAGACGTAATGCCGTC
AATCGTCATTTTTGATCCGCGGGAGTCAGTGAACAGGTACCATTTGCCGTTCATTTTAAAGACGTTCGCGCGTTCAATTT
CATCTGTTACTGTGTTAGATGCAATCAGCGGTTTCATCACTTTTTTCAGTGTGTAATCATCGTTTAGCTCAATCATACCG
AGAGCGCCGTTTGCTAACTCAGCCGGGCGTTTTTTATCGCTTTGCAGAAGTTTTTGACTTTCTTGACGGAAGAATGATGT
GCTTTTGCCATAGTATGCTTTGTTAAATAAAGATTCTTCGCCTTGGTAGCCATCTTCAGTTCCAGTGTTTGCTTCAAATA
CTAAGTATTTGTGGCCTTTATCTTCTACGTAGTGAGGATCTCTCAGCGTATGGTTGTCGCCTGAGCTGTAGTTGCCTTCA
TCGATGAACTGCTGTACATTTTGATACGTTTTTCCGTCACCGTCAAAGATTGATTTATAATCCTCTACACCGTTGATGTT
CAAAGAGCTGTCTGATGCTGATACGTTAACTTGTGCAGTTGTCAGTGTTTGTTTGCCGTAATGTTTACCGGAGAAATCAG
TGTAGAATAAACGGATTTTTCCGTCAGATGTAAATGTGGCTGAACCTGACCATTCTTGTGTTTGGTCTTTTAGGATAGAA
TCATTTGCATCGAATTTGTCGCTGTCTTTAAAGACGCGGCCAGCGTTTTTCCAGCTGTCAATAGAAGTTTCGCCGACTTT
TTGATAGAACATGTAAATCGATGTGTCATCCGCATTTTTAGGATCTCCGGCTAATGCAAAGACGATGTGGTAGCCGTGAT
AGTTTGCGACAGTGCCGTCAGCGTTTTGTAATGGCCAGCTGTCCCAAACGTCCAGGCCTTTTGCAGAAGAGATATTTTTA
ATTGTGGACGAATCAAATTCAGAAACTTGATATTTTTCATTTTTTTGCTGTTCAGGGATTTGCAGCATATCATGGCGTGT
AATATGGGAAATGCCGTATGTTTCCTTATATGGCTTTTGGTTCGTTTCTTCCGCAAACGCTTGAGTTGCGCCGTCGCTCT
GCGCGTGCGCCGACATGCAAGCGGCTGCGGTGAGCGCGGCGGCGCTCAGGGCCAAACGTTTGTGTCTACGGGAAACGGCT
TGTTTGGAGTACGTCATCGTTTCCTCCTAACGCTTAATTGTTATCCGCTCACAATTCCACACATTAAACTAGATTCGATG
ATTAATTGTCAACAGCTCACTAGTTTAATTAATCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATC
GGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCA
ACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATG
ATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATCCGCGCCTTGAGCCTGGCGAACAG
TTCGGCTGGCGCGAGCCCCTGATGCTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTC
GCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCC
ATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTC
CCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCT
CGTCTTGGAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAAC
ACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACC
TGCGTGCAATCCATCTTGTTCAATCATACTCTTCCTTTTTCAAATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAG
CGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACG
TCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGT
GATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACA
AGCCCGTCGCATGCATCTAGAGGGATCCGCTGCAGGGCGGCCGCTCAGGTCAGCACGGTCATGAATCGTTCGTTGAGAAT
GCGGTCGTGGTAAAAGATCGCCTTGCCCAGCTGGTCGGTGGTCCAGGTCACCGGTTTGTGGTCCGGGTAGTTGTAATCTC
CCCCGCAGAACACTTCGTTGCGGTTACCGGACGGGTCGAAGAAGTAGATGGTCTTGCCGTGAGTGAGGCCGTGGCGGGTT
GGGCCGATATCGATAGATGTGTCGGTCATGGAGATCAGGTCGGCGGCGCGAAGCAAGTCTTCCCAGGTTTCGAGGTGGAA
GGACACATGATGGAGGCGGCCTTTTTCCGGATGGTGAATGAAGGCCACGTCGTGGGCCTTGGTCGACAGACTGAGAAACT
GGGCGACGCGCGTGCCATTTTCGTCCAGCACCTGTTCGGCCAGATAGAAACCGAGCACCTTGGTGAACAGGTCATAGGTC
GCCGGCAATTCGTCGCCATACATGAGGGCGTGGTCGAAACGCACAGCCGCCATACCTTTCAGATCGCGCGGCCATGCCTC
GGGATTGACGTCATTCAAACCCCACTTTCCAGTATATTCCTTGTCTGCATACAACTCGAAGTGATGCCCGGAGGGGGCCT
GGAAGCGCACGCGCCGGCCACAACTGTTCAGTTCACCTGCGGGTAGCTGCTCAACGGCACAGCCATATGCCATCAGATCC
CGCTCCAGTTGCCGGAGAGCATCCTCATCCACAACCTTGAAACCCATAAAATCCATGCCCGGCTCGTCAGCCTCGCGTAG
CACCAGGGAAAACTTATCCACTTCGGTCCAAGCCTTCAGATAGACACGGCCCTGGTCGTCACGGTCCATCTCGATCAGGC
CCAGCAACTCGACGTAGTGTTCCAGGGCCTTGCTCATGTCCAGTACACGCAGCTGCACATGGCCCGGTCGCATTACACCT
TTGTTCATAGTATTCTGTCTCCTTCTGTGATATTCCACACATTATACGAGCCGATGATTAATGGTCAACAGCTCAAGCTT
CCCGGGTACCGAGCTCGAATTAGCTTCAAAAGCGCTCTGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGG
AACTTCAAGATCCCCTGATTCCCTTTGTCAACAGCAATGGATATCAGCCGTTGACTTAGTTGGTATTTCCGGAATATCAT
GCTGGGTTCCGAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGAAGAACAAGCGTGAACATGGCGCGATTGAA
GGGGGAGGTTTTGCCCGCCCTCTTCGCGTCGCCGGCGACGATTGGCGAGTACGGGGCCGGCATCGACGGGGCGGATTCCC
TCAACGAGCTGTCGAATCTGATGGAGCACGGCGCAGTTGCCGCGCTGGCCGACAAAATCAGCCAGATCGTGGCGAAGCTG
GTCGACGCGGACCCCCGCAAGATCGCGGAAAAGCCTACCTGGTTCGAGAAGATGCTTGGCCGTGAGGTTGAACGCCAGGT
GAGGTATCAGGTCGCCCGCAAGACGCTCGACCAGTTGCTGGACGAAGCCGAGGGCGTAGCGCAGCGCGTGCGGGACACGT
TGCGCGCCTTGGATGACATGCTCAATACGCATGAGGCCGAGGTAGACCGGCTCAGAGCCTACATTCAAGCCGGGCGCGAG
TTCCTGGACGAGAACCCCGAGGCCGGCGCGGCCAAGGCCGGCGTGATCGAGTTCGACAAGCCGCGCGAACGCTTCGCGCG
CAAGCTCGCCAACCTGGCAACCCTCATGGCGTCCCATGAAATGAGCGTCACTCAGATGAAGCTCACGCGGGCGCAGGCCG
TGGACATGCTGGACCGCTTCTCTGAAACGGCATCCGTCCTGGTGCCCGTCTGGCGTCAGCACACCCTCGCGCTCATCACC
ACCAAGAACATGAATCCGGCAATGGTCGCCGAGGCGGCCAAAGCTCACCAGGCGCTCATGCGGAGCCTTTCGCAGAGCCT
GGAAGGCATCAACCAATAACACGGCGGGAGAACCCTATGAACGCACTGAAAACGACGCACGACGCCAAGGCCCCTATCGT
CGCCTTTGACATGACCCCGGCAACCCTGCGCGAGCTGGGCTTGCAGGAAAGCGACGTGCCGGAAGTCCATGCGGTCGCGC
AGCGGATCGAGGTCGGCAGTCCGCAGACCGTTGCCGAGTTCGGCCGCGACGTGGCCGAGCACACGTCCCGCTACGCCGAT
AGCCTGCTGGACCAGGTGCGCAACAGCGACCTGGACGAAGCAGGCGAGAAACTGACCCAGGTTGTCGCCAAGGCCCGTTC
CCTGAACGTCGGCCCTTTGTCCGACAACCGTTCCCGCCTGCCCCTGATTGGCCCGCTGATCGACCGCTCCCGCGTCCGTT
CGACGGGCTTCATGGCGCGCTTCGACACGACCCGCGAGCAGATCGAACACCTGGTCAGCGAAGTGCAGACCACCCAGCAA
GGCATCGCGCAGCGCAATGCCTCGCTCGACGAAATGTTCGCAGCCGTGCGCGAGGAACACCGCCTTCTTGGCGTCCACAT
CGCGGCCGGCAAGGTCCGCCTTGCCGAGCTGCGCGAGCAGGCCGAGGGTCTGCGCGGCAATGTCGGGAACGACCCTGGCC
GCGTGCAGGAGCTGGCCGACCTCGATGCGATGGTTGCCAACCTGGACAAGCGCATCGGCGACCTGATCGCCTTGCAACAT
TCGGCCATGCAGAGCCTGCCGACCATCCGCATGATCCAGGCCAACAACCAGATGCTGGTCGATAAATTCCACACCATCCG
CGAAATCACCGTGCCGGCGTGGAAGCGGCAATTCATGCTGGCCTTGAGCCTCAACGAGCAGAAGAACGCCGTCGAACTGG
CCACGGCCATCGACGACACCACCAACGACCTGATGAAGCGCAATGCGGCCCTGCTGCATCGCACGTCCGTCGAGACGGCG
AAGGAGAACCAACGCCTGGTGATCGACGTGGACACGCTCAAGCAGGTTCAGACGACGCTCATCAAGACCGTCGAGGACGT
TATTCGCATCCAGCAGGAAGGCGTGCAGAAGCGCAAGGATGCCGAGAAGCAGATCGCCGCAATGCGTGGCGATCTTCAAG
CCAAGCTGACCCGCCAGCCCGTGCGCGAGCTGGCCCAACAGGAGTCCGT
//

Caution:
Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart