pMSCVpuro

$280.00

  • Model: PVTY00699
  • 20 Units in Stock
Ask a question


Add to Cart:

pMSCVpuro

PVTY00699  2ug

pMSCVpuro Description

Plasmid type: Retroviral vector Copy Number: Low copy Promoter: LTR Cloning Method: Multiple cloning sites,restriction endonuclease Size: 6264 bp 5' Sequencing primers and sequences: MSCV-F: CCCTTGAACCTCCTCGTTCGACC 3' Sequencing primers and sequences: pMSCV-R: GAGACGTGCTACTTCCATTTGTC Resistance(s): Ampicillin (Amp) Selectable markers: Hygromycin

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart