pMV261

$260.00

  • Model: PVT11359
  • 50 Units in Stock
Ask a question


Add to Cart:

pMV261


Catalog No. PVT11359
Packing 2ug

 

pMV261 Informaiton

Function /
Resistance Kan
Screen /
Strain DH5α
Culture temperature  LB/37℃
 

pMV261 Description

pMV261 is a Broad host plasmid and which size is 4488bp. Resistance is Kan.

 

pMV261 Sequence

GCTAGCCAACAAAGCGACGTTGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAAT
AAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGC
GATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATC
TATCGCTTGTATGGGAAGCCCCATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGA
TGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATG
CATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATT
GTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATT
TCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGC
CTGTTGAACAAGTCTGGAAAGAAATGCATAATCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCA
CTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCA
GGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTG
ATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAA
CACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAG
ATCACGCATCTTCCCGACAACGCAGACCGTTCCGTGGCAAAGCAAAAGTTCAAAATCACCAACTGGTCCACCTACAACAA
AGCTCTCATCAACCGTGGCTCCCTCACTTTCTGGCTGGATGATGGGGCGATTCAGGCCTGGTATGAGTCAGCAACACCTT
CTTCACGAGGCAGACCTCACTAGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTT
TTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACC
AACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCC
ACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGAT
AAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTG
CACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTC
CCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGA
AACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGG
GCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCT
TTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACG
ACCGAGCGCAACGCGTGAGCCCACCAGCTCCGTAAGTTCGGGTGCTGTGTGGCTCGTACCCGCGCATTCAGGCGGCAGGG
GGTCTAACGGGTCTAAGGCGGCGTGTACGGCCGCCACAGCGGCTCTTAGCGGCCCGGAAACGTCCTCGAAACGACGCATG
TGTTCCTCCTGGTTGGTACAGGTGGTTGGGGGTGCTCGGCTGTCGCTGGTGTTTCATCATCAGGGCTCGACGGGAGAGCG
GGGGAGTGTGCAGTTGTGGGGTGGCCCCTCAGCGAAATATCTGACTTGGAGCTCGTGTCGGACCATACACCGGTGATTAA
TCGTGGTTTATTATCAAGCGTGAGCCACGTCGCCGACGAATTTGAGCAGCTCTGGCTGCCGTACTGGTCCCTGGCAAGCG
ACGATCTGCTCGAGGGGATCTACCGCCAAAGCCGCGCGTCGGCCCTAGGCCGCCGGTACATCGAGGCGAACCCAACAGCG
CTGGCAAACCTGCTGGTCGTGGACGTAGACCATCCAGACGCAGCGCTCCGAGCGCTCAGCGCCCGGGGGTCCCATCCGCT
GCCCAACGCGATCGTGGGCAATCGCGCCAACGGCCACGCACACGCAGTGTGGGCACTCAACGCCCCTGTTCCACGCACCG
AATACGCGCGGCGTAAGCCGCTCGCATACATGGCGGCGTGCGCCGAAGGCCTTCGGCGCGCCGTCGATGGCGACCGCAGT
TACTCAGGCCTCATGACCAAAAACCCCGGCCACATCGCCTGGGAAACGGAATGGCTCCACTCAGATCTCTACACACTCAG
CCACATCGAGGCCGAGCTCGGCGCGAACATGCCACCGCCGCGCTGGCGTCAGCAGACCACGTACAAAGCGGCTCCGACGC
CGCTAGGGCGGAATTGCGCACTGTTCGATTCCGTCAGGTTGTGGGCCTATCTTCCCGCCCTCATGCGGATCTACCTGCCG
ACCCGGAACGTGGACGGACTCGGCCGCGCGATCTATGCCGAGTGCCACGCGCGAAACGCCGAATTTCCGTGCAACGACGT
GTGTCCCGGACCGCTACCGGACAGCGAGGTCCGCGCCATCGCCAACAGCATTTGGCGTTGGATCACAACCAAGTCGCGCA
TTTGGGCGGACGGGATCGTGGTCTACGAGGCCACACTCAGTGCGCGCCATGCGGCCATCTCGCGGAAGGGCGCAGCAGCG
CGCACGGCGGCGAGCACAGTTGCGCGGCGCGCAAAGTCCGCGTCAGCCATGGAGGCATTGCTATGAGCGACGGCTACAGC
GACGGCTACAGCGACGGCTACAACTGGCAGCCGACTGTCCGCAAAAAGCGGCGCGTGACCGCCGCCGAAGGCGCTCGAAT
CACCGGACTATCCGAACGCCACGTCGTCCGGCTCGTGGCGCAGGAACGCAGCGAGTGGTTCGCCGAGCAGGCTGCACGCC
GCGAACGCATCCGCGCCTATCACGACGACGAGGGCCACTCTTGGCCGCAAACGGCCAAACATTTCGGGCTGCATCTGGAC
ACCGTTAAGCGACTCGGCTATCGGGCGAGGAAAGAGCGTGCGGCAGAACAGGAAGCGGCTCAAAAGGCCCACAACGAAGC
CGACAATCCACCGCTGTTCTAACGCAATTGGGGAGCGGGTGTCGCGGGGGTTCCGTGGGGGGTTCCGTTGCAACGGGTCG
GACAGGTAAAAGTCCTGGTAGACGCTAGTTTTCTGGTTTGGGCCATGCCTGTCTCGTTGCGTGTTTCGTTGCGTCCGTTT
TGAATACCAGCCAGACGAGACGGGGTTCTACGAATCTTGGTCGATACCAAGCCATTTCCGCTGAATATCGTGGAGCTCAC
CGCCAGAATCGGTGGTTGTGGTGATGTACGTGGCGAACTCCGTTGTAGTGCTTGTGGTGGCATCCGTGGCGCGGCCGCGG
TACCAGATCTTTAAATCTAGAGGTGACCACAACGACGCGCCCGCTTTGATCGGGGACGTCTGCGGCCGACCATTTACGGG
TCTTGTTGTCGTTGGCGGTCATGGGCCGAACATACTCACCCGGATCGGAGGGCCGAGGACAAGGTCGAACGAGGGGCATG
ACCCGGTGCGGGGCTTCTTGCACTCGGCATAGGCGAGTGCTAAGAATAACGTTGGCACTCGCGACCGGTGAGTCGTAGGT
CGGGACGGTGAGGCCAGGCCCGTCGTCGCAGCGAGTGGCAGCGAGGACAACTTGAGCCGTCCGTCGCGGGCACTGCGCCC
GGCCAGCGTAAGTAGCGGGGTTGCCGTCACCCGGTGACCCCCGGTTTCATCCCCGATCCGGAGGAATCACTTCGCAATGG
CCAAGACAATTGCGGATCCAGCTGCAGAATTCGAAGCTTATCGATGTCGACGTAGTTAACTAGCGTACGATCGACTGCCA
GGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCCGGCCATCATGGCCGC
GGTGATCA
//
 

Caution:
Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart