
  • Model: PVT1323
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT1323        2ug


pNF-KB-TA-LUC Information

Promoter: HSV-TK

Replicator: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid classification: mammalian cells, signal pathway reporting vectors

Plasmid size: 4.9kb

Prokaryotic resistance: Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: mammalian cells

Induction mode: no induction, instantaneous expression

5'sequencing primers: Sv40-polyA-R:GAAATTTGTGATGCTATTGC

3'sequencing primers: primers designed according to sequence


pNF-KB-TA-LUC Description

pNF-KB-TA-LUC is a lactation report plasmid.



pNF-KB-TA-LUC Sequence

LOCUS       Exported                4902 bp ds-DNA     circular SYN 13-MAR-2018

DEFINITION  synthetic circular DNA

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 4902)

FEATURES             Location/Qualifiers

     source          1..4902

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     misc_feature    34..73


     promoter        86..117


                     /note="minimal TATA-box promoter with low basal activity"

     regulatory      173..182


                     /note="vertebrate consensus sequence for strong initiation 

                     of translation (Kozak, 1987)"

     CDS             179..1831



                     /product="firefly luciferase"


                     /note="enhanced luc+ version of the luciferase gene"











     polyA_signal    1872..1993

                     /label=SV40 poly(A) signal

                     /note="SV40 polyadenylation signal"

     rep_origin      complement(2412..3000)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(3171..4031)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     promoter        complement(4032..4136)


                     /label=AmpR promoter

     rep_origin      4163..4618


                     /label=f1 ori

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"

     polyA_signal    4749..4797

                     /note="synthetic polyadenylation signal"

     misc_feature    4811..4902

                     /label=pause site

                     /note="RNA polymerase II transcriptional pause signal from 

                     the human alpha-2 globin gene"

BASE COUNT         1275 a         1159 c         1181 g         1286 t


        1 atcgataggt accgagctct tacgcgtgct agcgggaatt tccgggaatt tccgggaatt

       61 tccgggaatt tccagatcta gactctagag ggtatataat ggaagctcga attccagctt

      121 ggcattccgg tactgttggt aaaaagcttg gcattccggt actgttggta aagccaccat

      181 ggaagacgcc aaaaacataa agaaaggccc ggcgccattc tatccgctgg aagatggaac

      241 cgctggagag caactgcata aggctatgaa gagatacgcc ctggttcctg gaacaattgc

      301 ttttacagat gcacatatcg aggtggacat cacttacgct gagtacttcg aaatgtccgt

      361 tcggttggca gaagctatga aacgatatgg gctgaataca aatcacagaa tcgtcgtatg

      421 cagtgaaaac tctcttcaat tctttatgcc ggtgttgggc gcgttattta tcggagttgc

      481 agttgcgccc gcgaacgaca tttataatga acgtgaattg ctcaacagta tgggcatttc

      541 gcagcctacc gtggtgttcg tttccaaaaa ggggttgcaa aaaattttga acgtgcaaaa

      601 aaagctccca atcatccaaa aaattattat catggattct aaaacggatt accagggatt

      661 tcagtcgatg tacacgttcg tcacatctca tctacctccc ggttttaatg aatacgattt

      721 tgtgccagag tccttcgata gggacaagac aattgcactg atcatgaact cctctggatc

      781 tactggtctg cctaaaggtg tcgctctgcc tcatagaact gcctgcgtga gattctcgca

      841 tgccagagat cctatttttg gcaatcaaat cattccggat actgcgattt taagtgttgt

      901 tccattccat cacggttttg gaatgtttac tacactcgga tatttgatat gtggatttcg

      961 agtcgtctta atgtatagat ttgaagaaga gctgtttctg aggagccttc aggattacaa

     1021 gattcaaagt gcgctgctgg tgccaaccct attctccttc ttcgccaaaa gcactctgat

     1081 tgacaaatac gatttatcta atttacacga aattgcttct ggtggcgctc ccctctctaa

     1141 ggaagtcggg gaagcggttg ccaagaggtt ccatctgcca ggtatcaggc aaggatatgg

     1201 gctcactgag actacatcag ctattctgat tacacccgag ggggatgata aaccgggcgc

     1261 ggtcggtaaa gttgttccat tttttgaagc gaaggttgtg gatctggata ccgggaaaac

     1321 gctgggcgtt aatcaaagag gcgaactgtg tgtgagaggt cctatgatta tgtccggtta

     1381 tgtaaacaat ccggaagcga ccaacgcctt gattgacaag gatggatggc tacattctgg

     1441 agacatagct tactgggacg aagacgaaca cttcttcatc gttgaccgcc tgaagtctct

     1501 gattaagtac aaaggctatc aggtggctcc cgctgaattg gaatccatct tgctccaaca

     1561 ccccaacatc ttcgacgcag gtgtcgcagg tcttcccgac gatgacgccg gtgaacttcc

     1621 cgccgccgtt gttgttttgg agcacggaaa gacgatgacg gaaaaagaga tcgtggatta

     1681 cgtcgccagt caagtaacaa ccgcgaaaaa gttgcgcgga ggagttgtgt ttgtggacga

     1741 agtaccgaaa ggtcttaccg gaaaactcga cgcaagaaaa atcagagaga tcctcataaa

     1801 ggccaagaag ggcggaaaga tcgccgtgta attctagagt cggggcggcc ggccgcttcg

     1861 agcagacatg ataagataca ttgatgagtt tggacaaacc acaactagaa tgcagtgaaa

     1921 aaaatgcttt atttgtgaaa tttgtgatgc tattgcttta tttgtaacca ttataagctg

     1981 caataaacaa gttaacaaca acaattgcat tcattttatg tttcaggttc agggggaggt

     2041 gtgggaggtt ttttaaagca agtaaaacct ctacaaatgt ggtaaaatcg ataaggatcc

     2101 gtcgaccgat gcccttgaga gccttcaacc cagtcagctc cttccggtgg gcgcggggca

     2161 tgactatcgt cgccgcactt atgactgtct tctttatcat gcaactcgta ggacaggtgc

     2221 cggcagcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg

     2281 cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac

     2341 gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg

     2401 ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca

     2461 agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc

     2521 tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc

     2581 ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag

     2641 gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc

     2701 ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca

     2761 gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg

     2821 aagtggtggc ctaactacgg ctacactaga agaacagtat ttggtatctg cgctctgctg

     2881 aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct

     2941 ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa

     3001 gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa

     3061 gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa

     3121 tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc

     3181 ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga

     3241 ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca

     3301 atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc

     3361 ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat

     3421 tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc

     3481 attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt

     3541 tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc

     3601 ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg

     3661 gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt

     3721 gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg

     3781 gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga

     3841 aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg

     3901 taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg

     3961 tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt

     4021 tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc

     4081 atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca

     4141 tttccccgaa aagtgccacc tgacgcgccc tgtagcggcg cattaagcgc ggcgggtgtg

     4201 gtggttacgc gcagcgtgac cgctacactt gccagcgccc tagcgcccgc tcctttcgct

     4261 ttcttccctt cctttctcgc cacgttcgcc ggctttcccc gtcaagctct aaatcggggg

     4321 ctccctttag ggttccgatt tagtgcttta cggcacctcg accccaaaaa acttgattag

     4381 ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg tttttcgccc tttgacgttg

     4441 gagtccacgt tctttaatag tggactcttg ttccaaactg gaacaacact caaccctatc

     4501 tcggtctatt cttttgattt ataagggatt ttgccgattt cggcctattg gttaaaaaat

     4561 gagctgattt aacaaaaatt taacgcgaat tttaacaaaa tattaacgct tacaatttgc

     4621 cattcgccat tcaggctgcg caactgttgg gaagggcgat cggtgcgggc ctcttcgcta

     4681 ttacgccagc ccaagctacc atgataagta agtaatatta aggtacggga ggtacttgga

     4741 gcggccgcaa taaaatatct ttattttcat tacatctgtg tgttggtttt ttgtgtgaat

     4801 cgatagtact aacatacgct ctccatcaaa acaaaacgaa acaaaacaaa ctagcaaaat

     4861 aggctgtccc cagtgcaagt gcaggtgcca gaacatttct ct



Product is for research use only!


Search name

pNF-KB-TA-LUC,Plasmid pNF-KB-TA-LUC,pNF-KB-TA-LUC vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
