pNF-kB-Luc

$216.00

  • Model: PVT1322
  • 50 Units in Stock
Ask a question


Add to Cart:

pNF-kB-Luc

PVT1322    2ug

 

pNF-kB-Luc Information

Promoter: SV40
Replicon: pUC ori
Terminator: SV40 poly (A) signal
Plasmid classification: mammalian cells, signal pathway reporting carrier
Prokaryotic resistance: ampicillin Amp
Cloned strain: Escherichia coli DH5 alpha
Culture conditions: 37 centigrade, aerobic LB
Expression host: mammalian cells
Induction mode: no induction, instantaneous expression
5'sequencing primers: Sv40-polyA-R:GAAATTTGTGATGCTATTGC
3'sequencing primers: primers designed according to sequence

 

Caution:
Product is for research use only!

 

 

Search name

pNF-kB-Luc,Plasmid pNF-kB-Luc,pNF-kB-Luc vector

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart