pPB- CAG- empty- pgk- hph

$215.00

  • Model: PVT10887
  • 50 Units in Stock
Ask a question


Add to Cart:

pPB-CAG-empty-pgk-hph

Catalog No. PVT10887
Packing 2ug

 

pPB-CAG-empty-pgk-hph Informaiton

Function Mammal Editing plasmids

Prokaryotic resistance: ampicillin Amp

Screening markers: hygromycin Hyg

Cloned strain: Escherichia coli DH5 alpha

Culture conditions: 37 degrees centigrade

 

pPB-CAG-empty-pgk-hph Description

PPB-CAG-empty-pgk-hph is a transposable expression plasmid of mammalian cells

 

pPB-CAG-empty-pgk-hph Sequence

> MoCloF 5'-agcgaggaagcggaagagcg-3'
CCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCG
CAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGT
ATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGC
TCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCTTTAACCCTAGAAAGATAATCATATTGTG
ACGTACGTTAAAGATAATCATGCGTAAAATTGACGCATGTGTTTTATCGGTCTGTATATCGAGGTTTATT
TATTAATTTGAATAGATATTAAGTTTTATTATATTTACACTTACATACTAATAATAAATTCAACAAACAA
TTTATTTATGTTTATTTATTTATTAAAAAAAAACAAAAACTCAAAATTTCTTCTATAAAGTAACAAAACA
TAACTTCGTATAGCATACATTATACGAAGTTATCTCGACGCGGCCGCTCTAGCCTCGAGGCTAGAACTAG
TGGATCTCGAGCCCCAGCTGGTTCTTTCCGCCTCAGAAGCCATAGAGCCCACCGCATCCCCAGCATGCCT
GCTATTGTCTTCCCAATCCTCCCCCTTGCTGTCCTGCCCCACCCCACCCCCCAGAATAGAATGACACCTA
CTCAGACAATGCGATGCAATTTCCTCATTTTATTAGGAAAGGACAGTGGGAGTGGCACCTTCCAGGGTCA
AGGAAGGCACGGGGGAGGGGCAAACAACAGATGGCTGGCAACTAGAA
        
 
> F1ori-R 5'-AGGGAAGAAAGCGAAAGGAG-3'
GTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCgCGTCCCATT
CGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGC
GAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAA
ACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGTACCTTAACCCTAGAAAGATAGT
CTGCGTAAAATTGACGCATGCATTCTTGAAATATTGCTCTCTCTTTCTAAATAGCGCGAATCCGTCGCTG
TGCATTTAGGACATCTCAGTCGCCGCTTGGAGCTCCCGTGAGGCGTGCTTGTCAATGCGGTAAGTGTCAC
TGATTTTGAACTATAACGACCGCGTGAGTCAAAATGACGCATGATTATCTTTTACGTGACTTTTAAGATT
TAACTCATACGATAATTATATTGTTATTTCATGTTCTACTTACGTGATAACTTATTATATATATATTTTC
TTGTTATAGATATCCAACTATGAAACATTATCATAAAGCAATAGTAAAGAGCCTTCAGTAAAGAGCAGGC
ATTTATCTAATCCCACCCCACCCCCACCCCCGTAGCTCCAATCCTTCCATTCAAAATGTAGGTACTCTGT
TCTCACCCTTCTTAACAAAGTATGACAGGAAAAACTTCCATGTGGACATCTTTATTGTTTAATAGATCAT
CAATTTCTCGACTATTCCTTTGCCCTCGGACGAGTGCTGGGGCGTCGGTTTCCACTATCGGCGAGTACTT
CTACACAGCCATCGGTCCA
No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart