pPha- T1

$260.00

  • Model: PVT11388
  • 46 Units in Stock
Ask a question


Add to Cart:

pPha-T1


Catalog No. PVT11388
Packing 2ug

 

pPha-T1 Information

Prokaryotic resistance: Amp

Filter marker: Zeo

Clone strain: DH5a

Culture condition: 37 ℃

Plasmid host: wide host

Purpose of plasmid:-

Fragment type:-

Fragment species:-

Prokaryotic resistance: Amp

Filter marker: Zeo
 

pPha-T1 Sequence

gggctgcaggacgcaatggaggattatcaccgcaaaaatgaacttcgaaaaaaactttcgagcgaccatggaaaaggagg
atcagattcagattacaacagtggattgctctggtagcaaatatcttctgctagattggctcatggtcggttttggacgt
tcgaagctcaccgtcaaaagaaacaaaagagaagaatgacgtcttcgtgacgtagaatctacgactgtactcggatctgg
gaaatgaattgactcacggtcttcttcgagtcctgttacaggcccttggtccgaacccccacacgatttttgcaccaaag
atttgcttcaatttgctggatgttttgactgcaagatcagctggcctagcaagagtgctcgtgttgcttcgtcgggaatc
cctacgaatttcagttctgcacaaatttgtctgccgtttcgagaattcgatatcatcgactaattcgagctcggtacccg
gggatcctctagagtcgacctgcaggcatgcaagcttcagaagcgtgctatcgaactcaaccagggacgtgcggcacaaa
tgggcatccttgctctcatggtgcacgaacagttgggagtctctatccttccttaaaaatttaattttcattagttgcag
tcactccgctttggtttcacagtcaggaataacactagctcgtcttcaccatggatgccaatctcgcctattcatggtgt
ataaaagttcaacatccaaagctagaacttttggaaagagaaagaatatccgaatagggcacggcgtgccgtattgttgg
agtggactagcagaaagtgaggaaggcacaggatgagttttctcgagacataccttcagcgtcgtcttcactgtcacagt
caactgacagtaatcgttgatccggagagattcaaaattcaatctgtttggacctggataagacacaagagcgacatcct
gacatgaacgccgtaaacagcaaatcctggttgaacacgtatccttttgggggcctccgctacgacgctcgctccagctg
gggcttccttactatacacagcgcgcatatttcacggttgccagatgtcaagatggccaagttgaccagtgccgttccgg
tgctcaccgcgcgcgacgtcgccggagcggtcgagttctggaccgaccggctcgggttctcccgggacttcgtggaggac
gacttcgccggtgtggtccgggacgacgtgaccctgttcatcagcgcggtccaggaccaggtggtgccggacaacaccct
ggcctgggtgtgggtgcgcggcctggacgagctgtacgccgagtggtcggaggtcgtgtccacgaacttccgggacgcct
ccgggccggccatgaccgagatcggcgagcagccgtgggggcgggagttcgccctgcgcgacccggccggcaactgcgtg
cacttcgtggccgaggagcaggactgaaccttccttaaaaatttaattttcattagttgcagtcactccgctttggtttc
acagtcaggaataacactagctcgtcttcaccatggatgccaatctcgcctattcatggtgtataaaagttcaacatcca
aagctagaacttttggaaagagaaagaatatccgaatagggcacggcgtgccgtattgttggagtggactagcagaaagt
gaggaaggcacaggatgagttttctcgaggccggtctccctatagtgagtcgtattaatttcgataagccaggttaacct
gcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgc
tgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggat
aacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttcca
taggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagat
accaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgccttt
ctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagct
gggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaa
gacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttc
ttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcgg
aaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagatta
cgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgt
taagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaat
ctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctat
ttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgct
gcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcag
aagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagtta
atagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctcc
ggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgt
tgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccg
taagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgc
ccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcg
aaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatctt
ttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaa
tgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatt
tgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaacca
ttattatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtctcgcgcgtttcggtgatgacggtgaa
aacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcaggg
cgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccata
tggacatattgtcgttagaacgcggctacaattaatacataaccttatgtatcatacacatacgatttaggtgacactat
agaaccagatccccc

//

 


Caution:
1.  This product is FOR RESEARCH USE ONLY!
2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart