pPIC3.5K

Search name

pPIC3.5K,Plasmid pPIC3.5K,pPIC3.5K vector

 

pPIC3.5K  Information

Promoter: AOX1

Replicon: pBR322 ori

Plasmid classification: yeast series, Pichia pastoris expression vector.

Plasmid size: 9004bp

Prokaryotic resistance: Amp

Screening markers: HIS4

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: yeast cells

5'sequencing primers: AOX5:GACTGGTTCCAATTGACAAGC

3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT

Use: Yeast expression

 

pPIC3.5K  Description

PIC3.5K is a vector for identifying multiple copies of genes inserted into Pichia pastoris genome. The size of the 1. pPIC3.5K carrier is 9004 BP. 
2., in the region of polyclonal sites, there are 5 single restriction sites: BamH I, Snab I, EcoR I, Avr II and Not I. 
3. intracellular expression. When constructing the 
4. vector, we need to include a ATG promoter and Kozak sequence. (Cavener and Stuart, 1991; Kozak, 1987; Kozak, 1990) 
5. HIS4 gene screening in Pichia pastoris. 
6. inserting genes into AOX1 of GS115 and KM71 requires the use of Sac I linearized plasmids (the genotype produced by GS115 is His+ Mut+, and the genotype produced by KM71 yeast is His+ MutS). 
7. inserting genes into HIS4 of GS115 and KM71 requires the use of Sal I linearized plasmids (the genotype produced by GS115 is His+ Mut+, and the genotype produced by KM71 yeast is His+ MutS). 
8., insert the gene into the AOX1 gene of GS115, and also use Bgl II restriction enzyme to linearize plasmid, and the yeast genotype produced is His+ MutS.

pPIC3.5K  Sequence