pPIC3.5K Plasmid


  • Model: PVT4001
  • 49 Units in Stock
Ask a question

Add to Cart:


Search name

pPIC3.5K,Plasmid pPIC3.5K,pPIC3.5K vector


pPIC3.5K  Information

Promoter: AOX1

Replicon: pBR322 ori

Plasmid classification: yeast series, Pichia pastoris expression vector.

Plasmid size: 9004bp

Prokaryotic resistance: Amp

Screening markers: HIS4

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: yeast cells

5'sequencing primers: AOX5:GACTGGTTCCAATTGACAAGC

3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT

Use: Yeast expression


pPIC3.5K  Description

PIC3.5K is a vector for identifying multiple copies of genes inserted into Pichia pastoris genome. The size of the 1. pPIC3.5K carrier is 9004 BP. 
2., in the region of polyclonal sites, there are 5 single restriction sites: BamH I, Snab I, EcoR I, Avr II and Not I. 
3. intracellular expression. When constructing the 
4. vector, we need to include a ATG promoter and Kozak sequence. (Cavener and Stuart, 1991; Kozak, 1987; Kozak, 1990) 
5. HIS4 gene screening in Pichia pastoris. 
6. inserting genes into AOX1 of GS115 and KM71 requires the use of Sac I linearized plasmids (the genotype produced by GS115 is His+ Mut+, and the genotype produced by KM71 yeast is His+ MutS). 
7. inserting genes into HIS4 of GS115 and KM71 requires the use of Sal I linearized plasmids (the genotype produced by GS115 is His+ Mut+, and the genotype produced by KM71 yeast is His+ MutS). 
8., insert the gene into the AOX1 gene of GS115, and also use Bgl II restriction enzyme to linearize plasmid, and the yeast genotype produced is His+ MutS.


pPIC3.5K  Sequence

LOCUS       Exported File           9004 bp ds-DNA    circular SYN 31-1-2015
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 9004)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-1-31  
FEATURES             Location/Qualifiers
     source          1..9004
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     terminator      1049..1295
                     /gene="Pichia pastoris AOX1"
                     /note="AOX1 terminator"
                     /note="transcription terminator for AOX1"
     CDS             complement(1708..4242)
                     /gene="Pichia pastoris HIS4"
                     /product="multifunctional enzyme, required for histidine 
                     /note="auxotrophic marker for Pichia pastoris"
     CDS             complement(4656..5471)
                     /product="aminoglycoside phosphotransferase"
                     /note="confers resistance to kanamycin in bacteria or G418 
                     (Geneticin(R)) in eukaryotes"
     misc_feature    5850..6606
                     /note="AOX1 3' fragment"
                     /note="region downstream of Pichia pastoris AOX1 gene"
     misc_feature    6749..6889
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(7075..7663)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(7834..8694)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(8695..8799)
                     /note="AmpR promoter"
        1 agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag
       61 gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt
      121 tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc
      181 agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta
      241 acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta
      301 tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg
      361 agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct
      421 gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg
      481 ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcgcca taccgtttgt
      541 cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct
      601 ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct
      661 ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact
      721 gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat
      781 atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt
      841 actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga
      901 caacttgaga ag
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
