
  • Model: PVT4002
  • 49 Units in Stock
Ask a question

Add to Cart:


PVT4002  2ug


pPIC9 Information

Promoter: AOX1

Replicon: pBR322 ori

Plasmid classification: yeast series, Pichia pastoris expression vector

Plasmid size: 8023bp

Prokaryotic resistance: Amp

Screening markers: HIS4

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: yeast cells

5'sequencing primers: AOX5:GACTGGTTCCAATTGACAAGC

3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT

Use: Yeast expression


pPIC9 Description

pPIC9 is a vector for identifying multiple copy genes inserted into Pichia pastoris genome.

1. the size of pPIC9 carrier is 8023 BP, which is a fusion expression vector.

2., the single restriction endonuclease site available for construction is Xho I, SnaB I, EcoR I, Avr II, Not I..

3. using alpha factor to secrete signal peptide, secreting the expressed protein gene.

4. in the process of vector construction, your genes must be consistent with the reading codon of the signal codon.

5. Pichia pastoris was screened by HIS4.

6. in order to insert the gene into the AOX region of GS115 or KM71, SacI restrictive endonuclease linearization plasmids (His+Mut+ genotypes in GS115, His+ MutS genotypes in KM71) are used.

In order to insert the gene into the His4 region of GS115 or KM71, 7.. Uses a Sal I or Stu I restriction endonuclease linearized plasmid.

8. inserting genes into the AOX1 region of GS115 requires the use of Bgl II linearization plasmid (producing His+MutS genotype).



pPIC9 Sequence

LOCUS       Exported                8023 bp ds-DNA     circular SYN 09-SEP-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled 2

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 8023)


  TITLE     Direct Submission

  JOURNAL   Exported Friday, September 9, 2016 from SnapGene Viewer 3.1.4

FEATURES             Location/Qualifiers

     source          1..8023

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     promoter        2..937

                     /gene="Pichia pastoris AOX1"

                     /note="AOX1 promoter"

                     /note="inducible promoter, regulated by methanol"

     CDS             949..1215



                     /product="N-terminal secretion signal from S. cerevisiae 


                     /note="alpha-factor secretion signal"

                     /note="Cleavage by the Kex2 protease occurs after the 

                     dibasic KR sequence. The EA dipeptides are then removed by 

                     dipeptidyl aminopeptidase A."



     terminator      1321..1567

                     /gene="Pichia pastoris AOX1"

                     /note="AOX1 terminator"

                     /note="transcription terminator for AOX1"

     CDS             complement(1980..4514)


                     /gene="Pichia pastoris HIS4"

                     /product="multifunctional enzyme, required for histidine 



                     /note="auxotrophic marker for Pichia pastoris"
















     misc_feature    4869..5625

                     /note="AOX1 3' fragment"

                     /note="region downstream of Pichia pastoris AOX1 gene"

     misc_feature    5768..5908


                     /note="basis of mobility region from pBR322"

     rep_origin      complement(6094..6682)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(6853..7713)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     promoter        complement(7714..7818)


                     /note="AmpR promoter"


        1 agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag

       61 gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt

      121 tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc

      181 agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta

      241 acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta

      301 tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg

      361 agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct

      421 gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg

      481 ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcgcca taccgtttgt

      541 cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct

      601 ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct

      661 ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact

      721 gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat

      781 atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt

      841 actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga

      901 caacttgaga agatcaaaaa acaactaatt attcgaagga tccaaacgat gagatttcct

      961 tcaattttta ctgcagtttt attcgcagca tcctccgcat tagctgctcc agtcaacact

     1021 acaacagaag atgaaacggc acaaattccg gctgaagctg tcatcggtta ctcagattta

     1081 gaaggggatt tcgatgttgc tgttttgcca ttttccaaca gcacaaataa cgggttattg

     1141 tttataaata ctactattgc cagcattgct gctaaagaag aaggggtatc tctcgagaaa

     1201 agagaggctg aagcttacgt agaattccct agggcggccg cgaattaatt cgccttagac

     1261 atgactgttc ctcagttcaa gttgggcact tacgagaaga ccggtcttgc tagattctaa

     1321 tcaagaggat gtcagaatgc catttgcctg agagatgcag gcttcatttt tgatactttt

     1381 ttatttgtaa cctatatagt ataggatttt ttttgtcatt ttgtttcttc tcgtacgagc

     1441 ttgctcctga tcagcctatc tcgcagctga tgaatatctt gtggtagggg tttgggaaaa

     1501 tcattcgagt ttgatgtttt tcttggtatt tcccactcct cttcagagta cagaagatta

     1561 agtgagaagt tcgtttgtgc aagcttatcg ataagcttta atgcggtagt ttatcacagt

     1621 taaattgcta acgcagtcag gcaccgtgta tgaaatctaa caatgcgctc atcgtcatcc

     1681 tcggcaccgt caccctggat gctgtaggca taggcttggt tatgccggta ctgccgggcc

     1741 tcttgcggga tatcgtccat tccgacagca tcgccagtca ctatggcgtg ctgctagcgc

     1801 tatatgcgtt gatgcaattt ctatgcgcac ccgttctcgg agcactgtcc gaccgctttg

     1861 gccgccgccc agtcctgctc gcttcgctac ttggagccac tatcgactac gcgatcatgg

     1921 cgaccacacc cgtcctgtgg atctatcgaa tctaaatgta agttaaaatc tctaaataat

     1981 taaataagtc ccagtttctc catacgaacc ttaacagcat tgcggtgagc atctagacct

     2041 tcaacagcag ccagatccat cactgcttgg ccaatatgtt tcagtccctc aggagttacg

     2101 tcttgtgaag tgatgaactt ctggaaggtt gcagtgttaa ctccgctgta ttgacgggca

     2161 tatccgtacg ttggcaaagt gtggttggta ccggaggagt aatctccaca actctctgga

     2221 gagtaggcac caacaaacac agatccagcg tgttgtactt gatcaacata agaagaagca

     2281 ttctcgattt gcaggatcaa gtgttcagga gcgtactgat tggacatttc caaagcctgc

     2341 tcgtaggttg caaccgatag ggttgtagag tgtgcaatac acttgcgtac aatttcaacc

     2401 cttggcaact gcacagcttg gttgtgaaca gcatcttcaa ttctggcaag ctccttgtct

     2461 gtcatatcga cagccaacag aatcacctgg gaatcaatac catgttcagc ttgagacaga

     2521 aggtctgagg caacgaaatc tggatcagcg tatttatcag caataactag aacttcagaa

     2581 ggcccagcag gcatgtcaat actacacagg gctgatgtgt cattttgaac catcatcttg

     2641 gcagcagtaa cgaactggtt tcctggacca aatattttgt cacacttagg aacagtttct

     2701 gttccgtaag ccatagcagc tactgcctgg gcgcctcctg ctagcacgat acacttagca

     2761 ccaaccttgt gggcaacgta gatgacttct ggggtaaggg taccatcctt cttaggtgga

     2821 gatgcaaaaa caatttcttt gcaaccagca actttggcag gaacacccag catcagggaa

     2881 gtggaaggca gaattgcggt tccaccagga atatagaggc caactttctc aataggtctt

     2941 gcaaaacgag agcagactac accagggcaa gtctcaactt gcaacgtctc cgttagttga

     3001 gcttcatgga atttcctgac gttatctata gagagatcaa tggctctctt aacgttatct

     3061 ggcaattgca taagttcctc tgggaaagga gcttctaaca caggtgtctt caaagcgact

     3121 ccatcaaact tggcagttag ttctaaaagg gctttgtcac cattttgacg aacattgtcg

     3181 acaattggtt tgactaattc cataatctgt tccgttttct ggataggacg acgaagggca

     3241 tcttcaattt cttgtgagga ggccttagaa acgtcaattt tgcacaattc aatacgacct

     3301 tcagaaggga cttctttagg tttggattct tctttaggtt gttccttggt gtatcctggc

     3361 ttggcatctc ctttccttct agtgaccttt agggacttca tatccaggtt tctctccacc

     3421 tcgtccaacg tcacaccgta cttggcacat ctaactaatg caaaataaaa taagtcagca

     3481 cattcccagg ctatatcttc cttggattta gcttctgcaa gttcatcagc ttcctcccta

     3541 attttagcgt tcaacaaaac ttcgtcgtca aataaccgtt tggtataaga accttctgga

     3601 gcattgctct tacgatccca caaggtggct tccatggctc taagaccctt tgattggcca

     3661 aaacaggaag tgcgttccaa gtgacagaaa ccaacacctg tttgttcaac cacaaatttc

     3721 aagcagtctc catcacaatc caattcgata cccagcaact tttgagttgc tccagatgta

     3781 gcacctttat accacaaacc gtgacgacga gattggtaga ctccagtttg tgtccttata

     3841 gcctccggaa tagacttttt ggacgagtac accaggccca acgagtaatt agaagagtca

     3901 gccaccaaag tagtgaatag accatcgggg cggtcagtag tcaaagacgc caacaaaatt

     3961 tcactgacag ggaacttttt gacatcttca gaaagttcgt attcagtagt caattgccga

     4021 gcatcaataa tggggattat accagaagca acagtggaag tcacatctac caactttgcg

     4081 gtctcagaaa aagcataaac agttctacta ccgccattag tgaaactttt caaatcgccc

     4141 agtggagaag aaaaaggcac agcgatacta gcattagcgg gcaaggatgc aactttatca

     4201 accagggtcc tatagataac cctagcgcct gggatcatcc tttggacaac tctttctgcc

     4261 aaatctaggt ccaaaatcac ttcattgata ccattattgt acaacttgag caagttgtcg

     4321 atcagctcct caaattggtc ctctgtaacg gatgactcaa cttgcacatt aacttgaagc

     4381 tcagtcgatt gagtgaactt gatcaggttg tgcagctggt cagcagcata gggaaacacg

     4441 gcttttccta ccaaactcaa ggaattatca aactctgcaa cacttgcgta tgcaggtagc

     4501 aagggaaatg tcatacttga agtcggacag tgagtgtagt cttgagaaat tctgaagccg

     4561 tatttttatt atcagtgagt cagtcatcag gagatcctct acgccggacg catcgtggcc

     4621 ggcatcaccg gcgccacagg tgcggttgct ggcgcctata tcgccgacat caccgatggg

     4681 gaagatcggg ctcgccactt cgggctcatg agcgcttgtt tcggcgtggg tatggtggca

     4741 ggccccgtgg ccgggggact gttgggcgcc atctccttgc atgcaccatt ccttgcggcg

     4801 gcggtgctca acggcctcaa cctactactg ggctgcttcc taatgcagga gtcgcataag

     4861 ggagagcgtc gagtatctat gattggaagt atgggaatgg tgatacccgc attcttcagt

     4921 gtcttgaggt ctcctatcag attatgccca actaaagcaa ccggaggagg agatttcatg

     4981 gtaaatttct ctgacttttg gtcatcagta gactcgaact gtgagactat ctcggttatg

     5041 acagcagaaa tgtccttctt ggagacagta aatgaagtcc caccaataaa gaaatccttg

     5101 ttatcaggaa caaacttctt gtttcgaact ttttcggtgc cttgaactat aaaatgtaga

     5161 gtggatatgt cgggtaggaa tggagcgggc aaatgcttac cttctggacc ttcaagaggt

     5221 atgtagggtt tgtagatact gatgccaact tcagtgacaa cgttgctatt tcgttcaaac

     5281 cattccgaat ccagagaaat caaagttgtt tgtctactat tgatccaagc cagtgcggtc

     5341 ttgaaactga caatagtgtg ctcgtgtttt gaggtcatct ttgtatgaat aaatctagtc

     5401 tttgatctaa ataatcttga cgagccaagg cgataaatac ccaaatctaa aactctttta

     5461 aaacgttaaa aggacaagta tgtctgcctg tattaaaccc caaatcagct cgtagtctga

     5521 tcctcatcaa cttgaggggc actatcttgt tttagagaaa tttgcggaga tgcgatatcg

     5581 agaaaaaggt acgctgattt taaacgtgaa atttatctca agatctctgc ctcgcgcgtt

     5641 tcggtgatga cggtgaaaac ctctgacaca tgcagctccc ggagacggtc acagcttgtc

     5701 tgtaagcgga tgccgggagc agacaagccc gtcagggcgc gtcagcgggt gttggcgggt

     5761 gtcggggcgc agccatgacc cagtcacgta gcgatagcgg agtgtatact ggcttaacta

     5821 tgcggcatca gagcagattg tactgagagt gcaccatatg cggtgtgaaa taccgcacag

     5881 atgcgtaagg agaaaatacc gcatcaggcg ctcttccgct tcctcgctca ctgactcgct

     5941 gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt

     6001 atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc

     6061 caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga

     6121 gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata

     6181 ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac

     6241 cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcaat gctcacgctg

     6301 taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc

     6361 cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag

     6421 acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt

     6481 aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta gaaggacagt

     6541 atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg

     6601 atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac

     6661 gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca

     6721 gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac

     6781 ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac

     6841 ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt

     6901 tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac gggagggctt

     6961 accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt

     7021 atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc

     7081 cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa

     7141 tagtttgcgc aacgttgttg ccattgctgc aggcatcgtg gtgtcacgct cgtcgtttgg

     7201 tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt

     7261 gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc

     7321 agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt

     7381 aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg

     7441 gcgaccgagt tgctcttgcc cggcgtcaac acgggataat accgcgccac atagcagaac

     7501 tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc

     7561 gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt

     7621 tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg

     7681 aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat attattgaag

     7741 catttatcag ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa

     7801 acaaataggg gttccgcgca catttccccg aaaagtgcca cctgacgtct aagaaaccat

     7861 tattatcatg acattaacct ataaaaatag gcgtatcacg aggccctttc gtcttcaaga

     7921 attaattctc atgtttgaca gcttatcatc gataagctga ctcatgttgg tattgtgaaa

     7981 tagacgcaga tcgggaacac tgaaaaataa cagttattat tcg


Product is for research use only!


Search name

pPIC9,Plasmid pPIC9,pPIC9 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
