

  • Model: PVT4003
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT4003      2ug


pPIC9k Infomation

Promoter: AOX1
Replicon: pBR322 ori
Plasmid classification: yeast series, Pichia pastoris expression vector
Plasmid size: 9276bp
Prokaryotic resistance: Amp, Kan
Screening markers: HIS4
Cloned strain: DH5 alpha
Culture conditions: 37 centigrade, aerobic LB
Expression host: yeast cells
5'sequencing primers: AOX5:GACTGGTTCCAATTGACAAGC
3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT
Use: Yeast expression


pPIC9k Description

Kana resistance gene exists in the pPIC9K vector, which allows the use of kana resistance to screen polyclonal copies in yeast. The size of the 1. carrier is 9276 BP. In the 2. vector construction process, the single restriction endonuclease loci available for SnaB I, EcoR I, Avr II, Not I. 3. use alpha factor to secrete signal peptide and secrete the expressed protein gene. 4. during the construction of the carrier, your gene must be guaranteed to be in accordance with the reading frame of the starting codon of the signal peptide. 5. Pichia pastoris was screened by HIS4. 6. in order to insert genes GS115 or KM71 AOX, using the SacI restriction endonuclease linearized plasmids (His+Mut+ genotype, GS115 KM71 His+ MutS 7.. Genotype) to insert genes GS115 or KM71 His4, using Sal I or Stu I restriction endonuclease of the linearized plasmid (His+ the genotype of Mut+, GS115 in KM71 His+ MutS genotype) 8. of the AOX1 gene into the GS115 region, need to use the Bgl II linearized plasmids (His+MutS genotype).



pPIC9k Sequence

LOCUS       Exported                9276 bp ds-DNA     circular SYN 10-SEP-2016

DEFINITION  synthetic circular DNA

KEYWORDS    Untitled 2

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 9276)


  TITLE     Direct Submission

FEATURES             Location/Qualifiers

     source          1..9276

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     promoter        2..937

                     /gene="Pichia pastoris AOX1"

                     /note="AOX1 promoter"

                     /note="inducible promoter, regulated by methanol"

     CDS             949..1215



                     /product="N-terminal secretion signal from S. cerevisiae 


                     /note="alpha-factor secretion signal"

                     /note="Cleavage by the Kex2 protease occurs after the 

                     dibasic KR sequence. The EA dipeptides are then removed by 

                     dipeptidyl aminopeptidase A."



     terminator      1321..1567

                     /gene="Pichia pastoris AOX1"

                     /note="AOX1 terminator"

                     /note="transcription terminator for AOX1"

     CDS             complement(1980..4514)


                     /gene="Pichia pastoris HIS4"

                     /product="multifunctional enzyme, required for histidine 



                     /note="auxotrophic marker for Pichia pastoris"
















     CDS             complement(4928..5743)



                     /product="aminoglycoside phosphotransferase"


                     /note="confers resistance to kanamycin in bacteria or G418 

                     (Geneticin(R)) in eukaryotes"






     misc_feature    6122..6878

                     /note="AOX1 3' fragment"

                     /note="region downstream of Pichia pastoris AOX1 gene"

     misc_feature    7021..7161


                     /note="basis of mobility region from pBR322"

     rep_origin      complement(7347..7935)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(8106..8966)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     promoter        complement(8967..9071)


                     /note="AmpR promoter"


        1 agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag

       61 gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt

      121 tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc

      181 agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta

      241 acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta

      301 tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg

      361 agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct

      421 gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg

      481 ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcgcca taccgtttgt

      541 cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct

      601 ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct

      661 ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact

      721 gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat

      781 atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt

      841 actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga

      901 caacttgaga agatcaaaaa acaactaatt attcgaagga tccaaacgat gagatttcct

      961 tcaattttta ctgcagtttt attcgcagca tcctccgcat tagctgctcc agtcaacact

     1021 acaacagaag atgaaacggc acaaattccg gctgaagctg tcatcggtta ctcagattta

     1081 gaaggggatt tcgatgttgc tgttttgcca ttttccaaca gcacaaataa cgggttattg

     1141 tttataaata ctactattgc cagcattgct gctaaagaag aaggggtatc tctcgagaaa

     1201 agagaggctg aagcttacgt agaattccct agggcggccg cgaattaatt cgccttagac

     1261 atgactgttc ctcagttcaa gttgggcact tacgagaaga ccggtcttgc tagattctaa

     1321 tcaagaggat gtcagaatgc catttgcctg agagatgcag gcttcatttt tgatactttt

     1381 ttatttgtaa cctatatagt ataggatttt ttttgtcatt ttgtttcttc tcgtacgagc

     1441 ttgctcctga tcagcctatc tcgcagctga tgaatatctt gtggtagggg tttgggaaaa

     1501 tcattcgagt ttgatgtttt tcttggtatt tcccactcct cttcagagta cagaagatta

     1561 agtgagaagt tcgtttgtgc aagcttatcg ataagcttta atgcggtagt ttatcacagt

     1621 taaattgcta acgcagtcag gcaccgtgta tgaaatctaa caatgcgctc atcgtcatcc

     1681 tcggcaccgt caccctggat gctgtaggca taggcttggt tatgccggta ctgccgggcc

     1741 tcttgcggga tatcgtccat tccgacagca tcgccagtca ctatggcgtg ctgctagcgc

     1801 tatatgcgtt gatgcaattt ctatgcgcac ccgttctcgg agcactgtcc gaccgctttg

     1861 gccgccgccc agtcctgctc gcttcgctac ttggagccac tatcgactac gcgatcatgg

     1921 cgaccacacc cgtcctgtgg atctatcgaa tctaaatgta agttaaaatc tctaaataat

     1981 taaataagtc ccagtttctc catacgaacc ttaacagcat tgcggtgagc atctagacct

     2041 tcaacagcag ccagatccat cactgcttgg ccaatatgtt tcagtccctc aggagttacg

     2101 tcttgtgaag tgatgaactt ctggaaggtt gcagtgttaa ctccgctgta ttgacgggca

     2161 tatccgtacg ttggcaaagt gtggttggta ccggaggagt aatctccaca actctctgga

     2221 gagtaggcac caacaaacac agatccagcg tgttgtactt gatcaacata agaagaagca

     2281 ttctcgattt gcaggatcaa gtgttcagga gcgtactgat tggacatttc caaagcctgc

     2341 tcgtaggttg caaccgatag ggttgtagag tgtgcaatac acttgcgtac aatttcaacc

     2401 cttggcaact gcacagcttg gttgtgaaca gcatcttcaa ttctggcaag ctccttgtct

     2461 gtcatatcga cagccaacag aatcacctgg gaatcaatac catgttcagc ttgagacaga

     2521 aggtctgagg caacgaaatc tggatcagcg tatttatcag caataactag aacttcagaa

     2581 ggcccagcag gcatgtcaat actacacagg gctgatgtgt cattttgaac catcatcttg

     2641 gcagcagtaa cgaactggtt tcctggacca aatattttgt cacacttagg aacagtttct

     2701 gttccgtaag ccatagcagc tactgcctgg gcgcctcctg ctagcacgat acacttagca

     2761 ccaaccttgt gggcaacgta gatgacttct ggggtaaggg taccatcctt cttaggtgga

     2821 gatgcaaaaa caatttcttt gcaaccagca actttggcag gaacacccag catcagggaa

     2881 gtggaaggca gaattgcggt tccaccagga atatagaggc caactttctc aataggtctt

     2941 gcaaaacgag agcagactac accagggcaa gtctcaactt gcaacgtctc cgttagttga

     3001 gcttcatgga atttcctgac gttatctata gagagatcaa tggctctctt aacgttatct

     3061 ggcaattgca taagttcctc tgggaaagga gcttctaaca caggtgtctt caaagcgact

     3121 ccatcaaact tggcagttag ttctaaaagg gctttgtcac cattttgacg aacattgtcg

     3181 acaattggtt tgactaattc cataatctgt tccgttttct ggataggacg acgaagggca

     3241 tcttcaattt cttgtgagga ggccttagaa acgtcaattt tgcacaattc aatacgacct

     3301 tcagaaggga cttctttagg tttggattct tctttaggtt gttccttggt gtatcctggc

     3361 ttggcatctc ctttccttct agtgaccttt agggacttca tatccaggtt tctctccacc

     3421 tcgtccaacg tcacaccgta cttggcacat ctaactaatg caaaataaaa taagtcagca

     3481 cattcccagg ctatatcttc cttggattta gcttctgcaa gttcatcagc ttcctcccta

     3541 attttagcgt tcaacaaaac ttcgtcgtca aataaccgtt tggtataaga accttctgga

     3601 gcattgctct tacgatccca caaggtggct tccatggctc taagaccctt tgattggcca

     3661 aaacaggaag tgcgttccaa gtgacagaaa ccaacacctg tttgttcaac cacaaatttc

     3721 aagcagtctc catcacaatc caattcgata cccagcaact tttgagttgc tccagatgta

     3781 gcacctttat accacaaacc gtgacgacga gattggtaga ctccagtttg tgtccttata

     3841 gcctccggaa tagacttttt ggacgagtac accaggccca acgagtaatt agaagagtca

     3901 gccaccaaag tagtgaatag accatcgggg cggtcagtag tcaaagacgc caacaaaatt

     3961 tcactgacag ggaacttttt gacatcttca gaaagttcgt attcagtagt caattgccga

     4021 gcatcaataa tggggattat accagaagca acagtggaag tcacatctac caactttgcg

     4081 gtctcagaaa aagcataaac agttctacta ccgccattag tgaaactttt caaatcgccc

     4141 agtggagaag aaaaaggcac agcgatacta gcattagcgg gcaaggatgc aactttatca

     4201 accagggtcc tatagataac cctagcgcct gggatcatcc tttggacaac tctttctgcc

     4261 aaatctaggt ccaaaatcac ttcattgata ccattattgt acaacttgag caagttgtcg

     4321 atcagctcct caaattggtc ctctgtaacg gatgactcaa cttgcacatt aacttgaagc

     4381 tcagtcgatt gagtgaactt gatcaggttg tgcagctggt cagcagcata gggaaacacg

     4441 gcttttccta ccaaactcaa ggaattatca aactctgcaa cacttgcgta tgcaggtagc

     4501 aagggaaatg tcatacttga agtcggacag tgagtgtagt cttgagaaat tctgaagccg

     4561 tatttttatt atcagtgagt cagtcatcag gagatcctct acgccggacg catcgtggcc

     4621 gacctgcagg gggggggggg gcgctgaggt ctgcctcgtg aagaaggtgt tgctgactca

     4681 taccaggcct gaatcgcccc atcatccagc cagaaagtga gggagccacg gttgatgaga

     4741 gctttgttgt aggtggacca gttggtgatt ttgaactttt gctttgccac ggaacggtct

     4801 gcgttgtcgg gaagatgcgt gatctgatcc ttcaactcag caaaagttcg atttattcaa

     4861 caaagccgcc gtcccgtcaa gtcagcgtaa tgctctgcca gtgttacaac caattaacca

     4921 attctgatta gaaaaactca tcgagcatca aatgaaactg caatttattc atatcaggat

     4981 tatcaatacc atatttttga aaaagccgtt tctgtaatga aggagaaaac tcaccgaggc

     5041 agttccatag gatggcaaga tcctggtatc ggtctgcgat tccgactcgt ccaacatcaa

     5101 tacaacctat taatttcccc tcgtcaaaaa taaggttatc aagtgagaaa tcaccatgag

     5161 tgacgactga atccggtgag aatggcaaaa gcttatgcat ttctttccag acttgttcaa

     5221 caggccagcc attacgctcg tcatcaaaat cactcgcatc aaccaaaccg ttattcattc

     5281 gtgattgcgc ctgagcgaga cgaaatacgc gatcgctgtt aaaaggacaa ttacaaacag

     5341 gaatcgaatg caaccggcgc aggaacactg ccagcgcatc aacaatattt tcacctgaat

     5401 caggatattc ttctaatacc tggaatgctg ttttcccggg gatcgcagtg gtgagtaacc

     5461 atgcatcatc aggagtacgg ataaaatgct tgatggtcgg aagaggcata aattccgtca

     5521 gccagtttag tctgaccatc tcatctgtaa catcattggc aacgctacct ttgccatgtt

     5581 tcagaaacaa ctctggcgca tcgggcttcc catacaatcg atagattgtc gcacctgatt

     5641 gcccgacatt atcgcgagcc catttatacc catataaatc agcatccatg ttggaattta

     5701 atcgcggcct cgagcaagac gtttcccgtt gaatatggct cataacaccc cttgtattac

     5761 tgtttatgta agcagacagt tttattgttc atgatgatat atttttatct tgtgcaatgt

     5821 aacatcagag attttgagac acaacgtggc tttccccccc ccccctgcag gtcggcatca

     5881 ccggcgccac aggtgcggtt gctggcgcct atatcgccga catcaccgat ggggaagatc

     5941 gggctcgcca cttcgggctc atgagcgctt gtttcggcgt gggtatggtg gcaggccccg

     6001 tggccggggg actgttgggc gccatctcct tgcatgcacc attccttgcg gcggcggtgc

     6061 tcaacggcct caacctacta ctgggctgct tcctaatgca ggagtcgcat aagggagagc

     6121 gtcgagtatc tatgattgga agtatgggaa tggtgatacc cgcattcttc agtgtcttga

     6181 ggtctcctat cagattatgc ccaactaaag caaccggagg aggagatttc atggtaaatt

     6241 tctctgactt ttggtcatca gtagactcga actgtgagac tatctcggtt atgacagcag

     6301 aaatgtcctt cttggagaca gtaaatgaag tcccaccaat aaagaaatcc ttgttatcag

     6361 gaacaaactt cttgtttcga actttttcgg tgccttgaac tataaaatgt agagtggata

     6421 tgtcgggtag gaatggagcg ggcaaatgct taccttctgg accttcaaga ggtatgtagg

     6481 gtttgtagat actgatgcca acttcagtga caacgttgct atttcgttca aaccattccg

     6541 aatccagaga aatcaaagtt gtttgtctac tattgatcca agccagtgcg gtcttgaaac

     6601 tgacaatagt gtgctcgtgt tttgaggtca tctttgtatg aataaatcta gtctttgatc

     6661 taaataatct tgacgagcca aggcgataaa tacccaaatc taaaactctt ttaaaacgtt

     6721 aaaaggacaa gtatgtctgc ctgtattaaa ccccaaatca gctcgtagtc tgatcctcat

     6781 caacttgagg ggcactatct tgttttagag aaatttgcgg agatgcgata tcgagaaaaa

     6841 ggtacgctga ttttaaacgt gaaatttatc tcaagatctc tgcctcgcgc gtttcggtga

     6901 tgacggtgaa aacctctgac acatgcagct cccggagacg gtcacagctt gtctgtaagc

     6961 ggatgccggg agcagacaag cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg

     7021 cgcagccatg acccagtcac gtagcgatag cggagtgtat actggcttaa ctatgcggca

     7081 tcagagcaga ttgtactgag agtgcaccat atgcggtgtg aaataccgca cagatgcgta

     7141 aggagaaaat accgcatcag gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg

     7201 gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca

     7261 gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac

     7321 cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac

     7381 aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg

     7441 tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac

     7501 ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc aatgctcacg ctgtaggtat

     7561 ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag

     7621 cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac

     7681 ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt

     7741 gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt

     7801 atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc

     7861 aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga

     7921 aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac

     7981 gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc

     8041 cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct

     8101 gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca

     8161 tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg cttaccatct

     8221 ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca

     8281 ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc

     8341 atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg

     8401 cgcaacgttg ttgccattgc tgcaggcatc gtggtgtcac gctcgtcgtt tggtatggct

     8461 tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgcaaa

     8521 aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta

     8581 tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc

     8641 ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg

     8701 agttgctctt gcccggcgtc aacacgggat aataccgcgc cacatagcag aactttaaaa

     8761 gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt accgctgttg

     8821 agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc

     8881 accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg

     8941 gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg aagcatttat

     9001 cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa taaacaaata

     9061 ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg tctaagaaac cattattatc

     9121 atgacattaa cctataaaaa taggcgtatc acgaggccct ttcgtcttca agaattaatt

     9181 ctcatgtttg acagcttatc atcgataagc tgactcatgt tggtattgtg aaatagacgc

     9241 agatcgggaa cactgaaaaa taacagttat tattcg



Product is for research use only!


Search name

pPIC9k,Plasmid pPIC9k,pPIC9k vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
