pPIC9k Plasmid


  • Model: PVT4003
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pPIC9k,Plasmid pPIC9k,pPIC9k vector


pPIC9k Infomation

Promoter: AOX1
Replicon: pBR322 ori
Plasmid classification: yeast series, Pichia pastoris expression vector
Plasmid size: 9276bp
Prokaryotic resistance: Amp, Kan
Screening markers: HIS4
Cloned strain: DH5 alpha
Culture conditions: 37 centigrade, aerobic LB
Expression host: yeast cells
5'sequencing primers: AOX5:GACTGGTTCCAATTGACAAGC
3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT
Use: Yeast expression



pPIC9k Description

Kana resistance gene exists in the pPIC9K vector, which allows the use of kana resistance to screen polyclonal copies in yeast. The size of the 1. carrier is 9276 BP. In the 2. vector construction process, the single restriction endonuclease loci available for SnaB I, EcoR I, Avr II, Not I. 3. use alpha factor to secrete signal peptide and secrete the expressed protein gene. 4. during the construction of the carrier, your gene must be guaranteed to be in accordance with the reading frame of the starting codon of the signal peptide. 5. Pichia pastoris was screened by HIS4. 6. in order to insert genes GS115 or KM71 AOX, using the SacI restriction endonuclease linearized plasmids (His+Mut+ genotype, GS115 KM71 His+ MutS 7.. Genotype) to insert genes GS115 or KM71 His4, using Sal I or Stu I restriction endonuclease of the linearized plasmid (His+ the genotype of Mut+, GS115 in KM71 His+ MutS genotype) 8. of the AOX1 gene into the GS115 region, need to use the Bgl II linearized plasmids (His+MutS genotype).



pPIC9k Sequence

LOCUS       Exported                9276 bp ds-DNA     circular SYN 10-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 9276)
  TITLE     Direct Submission
  JOURNAL   Exported Saturday, September 10, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..9276
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        2..937
                     /gene="Pichia pastoris AOX1"
                     /note="AOX1 promoter"
                     /note="inducible promoter, regulated by methanol"
     CDS             949..1215
                     /product="N-terminal secretion signal from S. cerevisiae 
                     /note="alpha-factor secretion signal"
                     /note="Cleavage by the Kex2 protease occurs after the 
                     dibasic KR sequence. The EA dipeptides are then removed by 
                     dipeptidyl aminopeptidase A."
     terminator      1321..1567
                     /gene="Pichia pastoris AOX1"
                     /note="AOX1 terminator"
                     /note="transcription terminator for AOX1"
     CDS             complement(1980..4514)
                     /gene="Pichia pastoris HIS4"
                     /product="multifunctional enzyme, required for histidine 
                     /note="auxotrophic marker for Pichia pastoris"
     CDS             complement(4928..5743)
                     /product="aminoglycoside phosphotransferase"
                     /note="confers resistance to kanamycin in bacteria or G418 
                     (Geneticin(R)) in eukaryotes"
     misc_feature    6122..6878
                     /note="AOX1 3' fragment"
                     /note="region downstream of Pichia pastoris AOX1 gene"
     misc_feature    7021..7161
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(7347..7935)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(8106..8966)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(8967..9071)
                     /note="AmpR promoter"
        1 agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
