
  • Model: PVT4006
  • 50 Units in Stock
Ask a question

Add to Cart:



Packing 2ug  


pPICZαA Information

Promoter: TEF1, AOX1, EM7

Replicon: pUC ori

Terminator: AOX1 TT

Plasmid classification: yeast series, Pichia pastoris expression vector

Plasmid size: 3593bp

Plasmid tagging: C-Myc, C-His

Prokaryotic resistance: Zeo

Selection marker: Zeo

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: yeast cells

Induction mode: methanol induction

5'sequencing primers: AOX5:GACTGGTTCCAATTGACAAGC

3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT



pPICZαA Description

PPICZ alpha A, B and C are 3.6 KB Pichia pastoris protein secreting expression vectors. The expressed recombinant protein is a fusion protein containing an N-terminal polypeptide encoding the secretory signal of a-factor from Saccharomyces cerevisiae. The vector can express the target protein at a high level in Pichia pastoris induced by methanol, and can be used in any Pichia pastoris, including X33, GS115, SMD1168H, KM71H. PPICZ alpha A, B and C series carriers contain the following contents:

(1) Strict regulation of the promoter of AOX1 at the 5'-terminus induces the expression of any gene of interest (Ellis et al., 1985; Koutz et al., 1989; tschopp et al., 1987A).

(2) alpha factor secreting signal can secrete the target protein.

(3) Zeocin resistance genes can be used for screening in E. coli and Pichia pastoris (Baron et al., 1992; Drocourt et al., 1990).

(4) C- ends contain Myc and His tags, which can be used to detect and purify recombinant proteins.

(5) pPICZ A, B, C three reading frames make it possible to clone the gene into the vector without any frame-shifting mutation.


pPICZαA Multiple cloning site



pPICZαA Sequence

LOCUS       Exported                3593 bp ds-DNA     circular SYN 10-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 5
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3593)
  TITLE     Direct Submission
  JOURNAL   Exported Saturday, September 10, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..3593
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        2..940
                     /gene="Pichia pastoris AOX1"
                     /note="AOX1 promoter"
                     /note="inducible promoter, regulated by methanol"
     CDS             941..1207
                     /product="N-terminal secretion signal from S. cerevisiae 
                     /note="alpha-factor secretion signal"
                     /note="Cleavage by the Kex2 protease occurs after the 
                     dibasic KR sequence. The EA dipeptides are then removed by 
                     dipeptidyl aminopeptidase A."
     CDS             1275..1304
                     /product="Myc (human c-Myc oncogene) epitope tag"
     CDS             1320..1337
                     /product="6xHis affinity tag"
     terminator      1417..1663
                     /gene="Pichia pastoris AOX1"
                     /note="AOX1 terminator"
                     /note="transcription terminator for AOX1"
     promoter        1678..2089
                     /gene="S. cerevisiae TEF1"
                     /note="TEF1 promoter"
                     /note="promoter for EF-1-alpha"
     promoter        2097..2144
                     /note="EM7 promoter"
                     /note="synthetic bacterial promoter "
     CDS             2163..2537
                     /gene="Sh ble from Streptoalloteichus hindustanus"
                     /product="antibiotic-binding protein"
                     /note="confers resistance to bleomycin, phleomycin, and 
     terminator      2603..2850
                     /gene="S. cerevisiae CYC1"
                     /note="CYC1 terminator"
                     /note="transcription terminator for CYC1"
     rep_origin      complement(2925..3513)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag
       61 gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt
      121 tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc
      181 agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta
      241 acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta
      301 tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg
      361 agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct
      421 gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg
      481 ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcggca taccgtttgt
      541 cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct
      601 ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct
      661 ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact
      721 gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat
      781 atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt
      841 actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga
      901 caacttgaga agatcaaaaa acaactaatt attcgaaacg atgagatttc cttcaatttt
      961 tactgctgtt ttattcgcag catcctccgc attagctgct ccagtcaaca ctacaacaga
     1021 agatgaaacg gcacaaattc cggctgaagc tgtcatcggt tactcagatt tagaagggga
     1081 tttcgatgtt gctgttttgc cattttccaa cagcacaaat aacgggttat tgtttataaa
     1141 tactactatt gccagcattg ctgctaaaga agaaggggta tctctcgaga aaagagaggc
     1201 tgaagctgaa ttcacgtggc ccagccggcc gtctcggatc ggtacctcga gccgcggcgg
     1261 ccgccagctt tctagaacaa aaactcatct cagaagagga tctgaatagc gccgtcgacc
     1321 atcatcatca tcatcattga gtttgtagcc ttagacatga ctgttcctca gttcaagttg
     1381 ggcacttacg agaagaccgg tcttgctaga ttctaatcaa gaggatgtca gaatgccatt
     1441 tgcctgagag atgcaggctt catttttgat acttttttat ttgtaaccta tatagtatag
     1501 gatttttttt gtcattttgt ttcttctcgt acgagcttgc tcctgatcag cctatctcgc
     1561 agctgatgaa tatcttgtgg taggggtttg ggaaaatcat tcgagtttga tgtttttctt
     1621 ggtatttccc actcctcttc agagtacaga agattaagtg agaccttcgt ttgtgcggat
     1681 cccccacaca ccatagcttc aaaatgtttc tactcctttt ttactcttcc agattttctc
     1741 ggactccgcg catcgccgta ccacttcaaa acacccaagc acagcatact aaattttccc
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
