
  • Model: PVT4006
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT4006  Packing 2ug  


pPICZαA Information

Promoter: TEF1, AOX1, EM7

Replicon: pUC ori

Terminator: AOX1 TT

Plasmid classification: yeast series, Pichia pastoris expression vector

Plasmid size: 3593bp

Plasmid tagging: C-Myc, C-His

Prokaryotic resistance: Zeo

Selection marker: Zeo

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: yeast cells

Induction mode: methanol induction

5'sequencing primers: AOX5:GACTGGTTCCAATTGACAAGC

3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT



pPICZαA Description

PPICZ alpha A, B and C are 3.6 KB Pichia pastoris protein secreting expression vectors. The expressed recombinant protein is a fusion protein containing an N-terminal polypeptide encoding the secretory signal of a-factor from Saccharomyces cerevisiae. The vector can express the target protein at a high level in Pichia pastoris induced by methanol, and can be used in any Pichia pastoris, including X33, GS115, SMD1168H, KM71H. PPICZ alpha A, B and C series carriers contain the following contents:

(1) Strict regulation of the promoter of AOX1 at the 5'-terminus induces the expression of any gene of interest (Ellis et al., 1985; Koutz et al., 1989; tschopp et al., 1987A).

(2) alpha factor secreting signal can secrete the target protein.

(3) Zeocin resistance genes can be used for screening in E. coli and Pichia pastoris (Baron et al., 1992; Drocourt et al., 1990).

(4) C- ends contain Myc and His tags, which can be used to detect and purify recombinant proteins.

(5) pPICZ A, B, C three reading frames make it possible to clone the gene into the vector without any frame-shifting mutation.


pPICZαA Multiple cloning site



pPICZαA Sequence

LOCUS       Exported                3593 bp ds-DNA     circular SYN 10-SEP-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled 5

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 3593)


  TITLE     Direct Submission

  JOURNAL   Exported Saturday, September 10, 2016 from SnapGene Viewer 3.1.4

FEATURES             Location/Qualifiers

     source          1..3593

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     promoter        2..940

                     /gene="Pichia pastoris AOX1"

                     /note="AOX1 promoter"

                     /note="inducible promoter, regulated by methanol"

     CDS             941..1207



                     /product="N-terminal secretion signal from S. cerevisiae 


                     /note="alpha-factor secretion signal"

                     /note="Cleavage by the Kex2 protease occurs after the 

                     dibasic KR sequence. The EA dipeptides are then removed by 

                     dipeptidyl aminopeptidase A."



     CDS             1275..1304


                     /product="Myc (human c-Myc oncogene) epitope tag"



     CDS             1320..1337


                     /product="6xHis affinity tag"



     terminator      1417..1663

                     /gene="Pichia pastoris AOX1"

                     /note="AOX1 terminator"

                     /note="transcription terminator for AOX1"

     promoter        1678..2089

                     /gene="S. cerevisiae TEF1"

                     /note="TEF1 promoter"

                     /note="promoter for EF-1-alpha"

     promoter        2097..2144

                     /note="EM7 promoter"

                     /note="synthetic bacterial promoter "

     CDS             2163..2537


                     /gene="Sh ble from Streptoalloteichus hindustanus"

                     /product="antibiotic-binding protein"


                     /note="confers resistance to bleomycin, phleomycin, and 





     terminator      2603..2850

                     /gene="S. cerevisiae CYC1"

                     /note="CYC1 terminator"

                     /note="transcription terminator for CYC1"

     rep_origin      complement(2925..3513)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 



        1 agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag

       61 gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt

      121 tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc

      181 agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta

      241 acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta

      301 tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg

      361 agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct

      421 gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg

      481 ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcggca taccgtttgt

      541 cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct

      601 ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct

      661 ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact

      721 gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat

      781 atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt

      841 actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga

      901 caacttgaga agatcaaaaa acaactaatt attcgaaacg atgagatttc cttcaatttt

      961 tactgctgtt ttattcgcag catcctccgc attagctgct ccagtcaaca ctacaacaga

     1021 agatgaaacg gcacaaattc cggctgaagc tgtcatcggt tactcagatt tagaagggga

     1081 tttcgatgtt gctgttttgc cattttccaa cagcacaaat aacgggttat tgtttataaa

     1141 tactactatt gccagcattg ctgctaaaga agaaggggta tctctcgaga aaagagaggc

     1201 tgaagctgaa ttcacgtggc ccagccggcc gtctcggatc ggtacctcga gccgcggcgg

     1261 ccgccagctt tctagaacaa aaactcatct cagaagagga tctgaatagc gccgtcgacc

     1321 atcatcatca tcatcattga gtttgtagcc ttagacatga ctgttcctca gttcaagttg

     1381 ggcacttacg agaagaccgg tcttgctaga ttctaatcaa gaggatgtca gaatgccatt

     1441 tgcctgagag atgcaggctt catttttgat acttttttat ttgtaaccta tatagtatag

     1501 gatttttttt gtcattttgt ttcttctcgt acgagcttgc tcctgatcag cctatctcgc

     1561 agctgatgaa tatcttgtgg taggggtttg ggaaaatcat tcgagtttga tgtttttctt

     1621 ggtatttccc actcctcttc agagtacaga agattaagtg agaccttcgt ttgtgcggat

     1681 cccccacaca ccatagcttc aaaatgtttc tactcctttt ttactcttcc agattttctc

     1741 ggactccgcg catcgccgta ccacttcaaa acacccaagc acagcatact aaattttccc

     1801 tctttcttcc tctagggtgt cgttaattac ccgtactaaa ggtttggaaa agaaaaaaga

     1861 gaccgcctcg tttctttttc ttcgtcgaaa aaggcaataa aaatttttat cacgtttctt

     1921 tttcttgaaa tttttttttt tagttttttt ctctttcagt gacctccatt gatatttaag

     1981 ttaataaacg gtcttcaatt tctcaagttt cagtttcatt tttcttgttc tattacaact

     2041 ttttttactt cttgttcatt agaaagaaag catagcaatc taatctaagg ggcggtgttg

     2101 acaattaatc atcggcatag tatatcggca tagtataata cgacaaggtg aggaactaaa

     2161 ccatggccaa gttgaccagt gccgttccgg tgctcaccgc gcgcgacgtc gccggagcgg

     2221 tcgagttctg gaccgaccgg ctcgggttct cccgggactt cgtggaggac gacttcgccg

     2281 gtgtggtccg ggacgacgtg accctgttca tcagcgcggt ccaggaccag gtggtgccgg

     2341 acaacaccct ggcctgggtg tgggtgcgcg gcctggacga gctgtacgcc gagtggtcgg

     2401 aggtcgtgtc cacgaacttc cgggacgcct ccgggccggc catgaccgag atcggcgagc

     2461 agccgtgggg gcgggagttc gccctgcgcg acccggccgg caactgcgtg cacttcgtgg

     2521 ccgaggagca ggactgacac gtccgacggc ggcccacggg tcccaggcct cggagatccg

     2581 tccccctttt cctttgtcga tatcatgtaa ttagttatgt cacgcttaca ttcacgccct

     2641 ccccccacat ccgctctaac cgaaaaggaa ggagttagac aacctgaagt ctaggtccct

     2701 atttattttt ttatagttat gttagtatta agaacgttat ttatatttca aatttttctt

     2761 ttttttctgt acagacgcgt gtacgcatgt aacattatac tgaaaacctt gcttgagaag

     2821 gttttgggac gctcgaaggc tttaatttgc aagctggaga ccaacatgtg agcaaaaggc

     2881 cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc

     2941 ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga

     3001 ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc

     3061 ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcaa

     3121 tgctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg

     3181 cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc

     3241 aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga

     3301 gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact

     3361 agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt

     3421 ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag

     3481 cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg

     3541 tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag atc


Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
