
  • Model: PVT4008
  • 50 Units in Stock
Ask a question

Add to Cart:




pPICZαB Information

Promoter: TEF1, AOX1, EM7

Replicon: pUC ori

Terminator: AOX1 TT

Plasmid classification: yeast series, Pichia pastoris expression vector

Plasmid tagging: C-Myc, C-His

Prokaryotic resistance: Zeo

Selection marker: Zeo

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: yeast cells

Induction mode: methanol induction

5'sequencing primers: AOX5:GACTGGTTCCAATTGACAAGC

3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT


pPICZαB Description

PPICZ alpha A, B and C are 3.6 KB Pichia pastoris protein secreting expression vectors. The expressed recombinant protein is a fusion protein containing an N-terminal polypeptide encoding the secretory signal of a-factor from Saccharomyces cerevisiae. The vector can express the target protein at a high level in Pichia pastoris induced by methanol, and can be used in any Pichia pastoris, including X33, GS115, SMD1168H, KM71H. PPICZ alpha A, B and C series carriers contain the following contents:

(1) Strict regulation of the promoter of AOX1 at the 5'-terminus induces the expression of any gene of interest (Ellis et al., 1985; Koutz et al., 1989; tschopp et al., 1987A).

(2) alpha factor secreting signal can secrete the target protein.

(3) Zeocin resistance genes can be used for screening in E. coli and Pichia pastoris (Baron et al., 1992; Drocourt et al., 1990).

(4) C- ends contain Myc and His tags, which can be used to detect and purify recombinant proteins.

(5) pPICZ A, B, C three reading frames make it possible to clone the gene into the vector without any frame-shifting mutation.


pPICZαB Multiple cloning site


pPICZαB Sequence

LOCUS       Exported                3597 bp ds-DNA     circular SYN 10-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 6
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3597)
  TITLE     Direct Submission
  JOURNAL   Exported Saturday, September 10, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..3597
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        2..940
                     /gene="Pichia pastoris AOX1"
                     /note="AOX1 promoter"
                     /note="inducible promoter, regulated by methanol"
     CDS             941..1207
                     /product="N-terminal secretion signal from S. cerevisiae 
                     /note="alpha-factor secretion signal"
                     /note="Cleavage by the Kex2 protease occurs after the 
                     dibasic KR sequence. The EA dipeptides are then removed by 
                     dipeptidyl aminopeptidase A."
     CDS             1279..1308
                     /product="Myc (human c-Myc oncogene) epitope tag"
     CDS             1324..1341
                     /product="6xHis affinity tag"
     terminator      1421..1667
                     /gene="Pichia pastoris AOX1"
                     /note="AOX1 terminator"
                     /note="transcription terminator for AOX1"
     promoter        1682..2093
                     /gene="S. cerevisiae TEF1"
                     /note="TEF1 promoter"
                     /note="promoter for EF-1-alpha"
     promoter        2101..2148
                     /note="EM7 promoter"
                     /note="synthetic bacterial promoter "
     CDS             2167..2541
                     /gene="Sh ble from Streptoalloteichus hindustanus"
                     /product="antibiotic-binding protein"
                     /note="confers resistance to bleomycin, phleomycin, and 
     terminator      2607..2854
                     /gene="S. cerevisiae CYC1"
                     /note="CYC1 terminator"
                     /note="transcription terminator for CYC1"
     rep_origin      complement(2929..3517)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag
       61 gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt
      121 tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc
      181 agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta
      241 acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta
      301 tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg
      361 agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct
      421 gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg
      481 ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcggca taccgtttgt
      541 cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct
      601 ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct
      661 ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact
      721 gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat
      781 atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt
      841 actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga
      901 caacttgaga agatcaaaaa acaactaatt attcgaaacg atgagatttc cttcaatttt
      961 tactgctgtt ttattcgcag catcctccgc attagctgct ccagtcaaca ctacaacaga
     1021 agatgaaacg gcacaaattc cggctgaagc tgtcatcggt tactcagatt tagaagggga
     1081 tttcgatgtt gctgttttgc cattttccaa cagcacaaat aacgggttat tgtttataaa
     1141 tactactatt gccagcattg ctgctaaaga agaaggggta tctctcgaga aaagagaggc
     1201 tgaagctgca ggaattcacg tggcccagcc ggccgtctcg gatcggtacc tcgagccgcg
     1261 gcggccgcca gctttctaga acaaaaactc atctcagaag aggatctgaa tagcgccgtc
     1321 gaccatcatc atcatcatca ttgagtttgt agccttagac atgactgttc ctcagttcaa
     1381 gttgggcact tacgagaaga ccggtcttgc tagattctaa tcaagaggat gtcagaatgc
     1441 catttgcctg agagatgcag gcttcatttt tgatactttt ttatttgtaa cctatatagt
     1501 ataggatttt ttttgtcatt ttgtttcttc tcgtacgagc ttgctcctga tcagcctatc
     1561 tcgcagctga tgaatatctt gtggtagggg tttgggaaaa tcattcgagt ttgatgtttt
     1621 tcttggtatt tcccactcct cttcagagta cagaagatta agtgagacct tcgtttgtgc
     1681 ggatccccca cacaccatag cttcaaaatg tttctactcc ttttttactc ttccagattt
     1741 tctcggactc cgcgcatcgc cgtaccactt caaaacaccc aagcacagca tactaaattt
     1801 tccctctt
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
