
  • Model: PVT4007
  • 50 Units in Stock
Ask a question

Add to Cart:



Packing 2ug


pPICZαC Information

Promoter: AOX1 promoter

Replicon: pUC ori

Terminator: AOX1

Plasmid size: 3598bp

Plasmid tagging: C-Myc, C-His

Prokaryotic resistance: Zeo

Selection marker: Zeo

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic, LB

Expression host: yeast cells

5'sequencing primers: AOX5:GACTGGTTCCAATTGACAAGC

3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT


pPICZαC Description

PPICZ alpha A, B and C are 3.6 KB Pichia pastoris protein secreting expression vectors. The expressed recombinant protein is a fusion protein containing an N-terminal polypeptide encoding the secretory signal of a-factor from Saccharomyces cerevisiae. The vector can express the target protein at a high level in Pichia pastoris induced by methanol, and can be used in any Pichia pastoris, including X33, GS115, SMD1168H, KM71H. PPICZ alpha A, B and C series carriers contain the following contents:

(1) Strict regulation of the promoter of AOX1 at the 5'-terminus induces the expression of any gene of interest (Ellis et al., 1985; Koutz et al., 1989; tschopp et al., 1987A).

(2) alpha factor secreting signal can secrete the target protein.

(3) Zeocin resistance genes can be used for screening in E. coli and Pichia pastoris (Baron et al., 1992; Drocourt et al., 1990).

(4) C- ends contain Myc and His tags, which can be used to detect and purify recombinant proteins.

(5) pPICZ A, B, C three reading frames make it possible to clone the gene into the vector without any frame-shifting mutation.


pPICZαC Multiple cloning site




pPICZαC Sequence

LOCUS       Exported                3598 bp ds-DNA     circular SYN 10-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 7
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3598)
  TITLE     Direct Submission
FEATURES             Location/Qualifiers
     source          1..3598
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        2..940
                     /gene="Pichia pastoris AOX1"
                     /note="AOX1 promoter"
                     /note="inducible promoter, regulated by methanol"
     CDS             1280..1309
                     /product="Myc (human c-Myc oncogene) epitope tag"
     CDS             1325..1342
                     /product="6xHis affinity tag"
     terminator      1422..1668
                     /gene="Pichia pastoris AOX1"
                     /note="AOX1 terminator"
                     /note="transcription terminator for AOX1"
     promoter        1683..2094
                     /gene="S. cerevisiae TEF1"
                     /note="TEF1 promoter"
                     /note="promoter for EF-1-alpha"
     promoter        2102..2149
                     /note="EM7 promoter"
                     /note="synthetic bacterial promoter "
     CDS             2168..2542
                     /gene="Sh ble from Streptoalloteichus hindustanus"
                     /product="antibiotic-binding protein"
                     /note="confers resistance to bleomycin, phleomycin, and 
     terminator      2608..2855
                     /gene="S. cerevisiae CYC1"
                     /note="CYC1 terminator"
                     /note="transcription terminator for CYC1"
     rep_origin      complement(2930..3518)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag
       61 gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt
      121 tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc
      181 agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta
      241 acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta
      301 tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg
      361 agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct
      421 gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg
      481 ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcggca taccgtttgt
      541 cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct
      601 ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct
      661 ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact
      721 gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat
      781 atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt
      841 actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga
      901 caacttgaga agatcaaaaa acaactaatt attcgaaacg atgagatttc cttcaatttt
      961 tactgctgtt ttattcgcag catcctccgc attagctgct ccagtcaaca ctacaacaga
     1021 agatgaaacg gcacaaattc cggctgaagc tgtcatcggt tactcagatt tagaagggga
     1081 tttcgatgtt gctgttttgc cattttccaa cagcacaaat aacgggttat tgtttataaa
     1141 tactactatt gccagcattg ctgctaaaga agaaggggta tctctcgaga agagagaggc
     1201 tgaagcatcg atgaattcac gtggcccagc cggccgtctc ggatcggtac ctcgagccgc
     1261 ggcggccgcc agctttctag aacaaaaact catctcagaa gaggatctga atagcgccgt
     1321 cgaccatcat catcatcatc attgagtttg tagccttaga catgactgtt cctcagttca
     1381 agttgggcac ttacgagaag accggtcttg ctagattcta atcaagagga tgtcagaatg
     1441 ccatttgcct gagagatgca ggcttcattt ttgatacttt tttatttgta acctatatag
     1501 tataggattt tttttgtcat tttgtttctt ctcgtacgag cttgctcctg atcagcctat
     1561 ctcgcagctg atgaatatct tgtggtaggg gtttgggaaa atcattcgag tttgatgttt
     1621 ttcttggtat ttcccactcc tcttcagagt acagaagatt aagtgagacc ttcgtttgtg
     1681 cggatccccc acacaccata gcttcaaaat gtttctactc cttttttact cttccagatt
     1741 ttctcggact ccgcgcatcg ccgtaccact tcaaaacacc caagcacagc atactaaatt
     1801 ttccctcttt cttcctctag ggtgtcgtta attacccgta ctaaaggttt ggaaaagaaa
     1861 aaagagaccg cctcgtttct ttttcttcgt cgaaaaaggc aataaaaatt tttatcacgt
     1921 ttctttttct tgaaattttt ttttttagtt tttttctctt tcagtgacct ccattgatat
     1981 ttaagttaat aaacggtctt caatttctca agtttcagtt tcatttttct tgttctatta
     2041 caactttttt tacttcttgt tcattagaaa gaaagcatag caatctaatc taaggggcgg
     2101 tgttgacaat taatcatcgg catagtatat cggcatagta taatacgaca aggtgaggaa
     2161 ctaaaccatg gccaagttga ccagtgccgt tccggtgctc accgcgcgcg acgtcgccgg
     2221 agcggtcgag ttctggaccg accggctcgg gttctcccgg gacttcgtgg aggacgactt
     2281 cgccggtgtg gtccgggacg acgtgaccct gttcatcagc gcggtccagg accaggtggt
     2341 gccggacaac accctggcct gggtgtgggt gcgcggcctg gacgagctgt acgccgagtg
     2401 gtcggaggtc gtgtccacga acttccggga cgcctccggg ccggccatga ccgagatcgg
     2461 cgagcagccg tgggggcggg agttcgccct gcgcgacccg gccggcaact gcgtgcactt
     2521 cgtggccgag gagcaggact gacacgtccg acggcggccc acgggtccca ggcctcggag
     2581 atccgtcccc cttttccttt gtcgatatca tgtaattagt tatgtcacgc ttacattcac
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
