
  • Model: PVT4007
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT4007        Packing 2ug

pPICZαC Information

Promoter: AOX1 promoter

Replicon: pUC ori

Terminator: AOX1

Plasmid size: 3598bp

Plasmid tagging: C-Myc, C-His

Prokaryotic resistance: Zeo

Selection marker: Zeo

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic, LB

Expression host: yeast cells

5'sequencing primers: AOX5:GACTGGTTCCAATTGACAAGC

3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT


pPICZαC Description

PPICZ alpha A, B and C are 3.6 KB Pichia pastoris protein secreting expression vectors. The expressed recombinant protein is a fusion protein containing an N-terminal polypeptide encoding the secretory signal of a-factor from Saccharomyces cerevisiae. The vector can express the target protein at a high level in Pichia pastoris induced by methanol, and can be used in any Pichia pastoris, including X33, GS115, SMD1168H, KM71H. PPICZ alpha A, B and C series carriers contain the following contents:

(1) Strict regulation of the promoter of AOX1 at the 5'-terminus induces the expression of any gene of interest (Ellis et al., 1985; Koutz et al., 1989; tschopp et al., 1987A).

(2) alpha factor secreting signal can secrete the target protein.

(3) Zeocin resistance genes can be used for screening in E. coli and Pichia pastoris (Baron et al., 1992; Drocourt et al., 1990).

(4) C- ends contain Myc and His tags, which can be used to detect and purify recombinant proteins.

(5) pPICZ A, B, C three reading frames make it possible to clone the gene into the vector without any frame-shifting mutation.


pPICZαC Multiple cloning site



pPICZαC Sequence

LOCUS       Exported                3598 bp ds-DNA     circular SYN 10-SEP-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled 7

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 3598)


  TITLE     Direct Submission

FEATURES             Location/Qualifiers

     source          1..3598

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     promoter        2..940

                     /gene="Pichia pastoris AOX1"

                     /note="AOX1 promoter"

                     /note="inducible promoter, regulated by methanol"

     CDS             1280..1309


                     /product="Myc (human c-Myc oncogene) epitope tag"



     CDS             1325..1342


                     /product="6xHis affinity tag"



     terminator      1422..1668

                     /gene="Pichia pastoris AOX1"

                     /note="AOX1 terminator"

                     /note="transcription terminator for AOX1"

     promoter        1683..2094

                     /gene="S. cerevisiae TEF1"

                     /note="TEF1 promoter"

                     /note="promoter for EF-1-alpha"

     promoter        2102..2149

                     /note="EM7 promoter"

                     /note="synthetic bacterial promoter "

     CDS             2168..2542


                     /gene="Sh ble from Streptoalloteichus hindustanus"

                     /product="antibiotic-binding protein"


                     /note="confers resistance to bleomycin, phleomycin, and 





     terminator      2608..2855

                     /gene="S. cerevisiae CYC1"

                     /note="CYC1 terminator"

                     /note="transcription terminator for CYC1"

     rep_origin      complement(2930..3518)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 



        1 agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag

       61 gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt

      121 tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc

      181 agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta

      241 acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta

      301 tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg

      361 agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct

      421 gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg

      481 ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcggca taccgtttgt

      541 cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct

      601 ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct

      661 ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact

      721 gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat

      781 atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt

      841 actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga

      901 caacttgaga agatcaaaaa acaactaatt attcgaaacg atgagatttc cttcaatttt

      961 tactgctgtt ttattcgcag catcctccgc attagctgct ccagtcaaca ctacaacaga

     1021 agatgaaacg gcacaaattc cggctgaagc tgtcatcggt tactcagatt tagaagggga

     1081 tttcgatgtt gctgttttgc cattttccaa cagcacaaat aacgggttat tgtttataaa

     1141 tactactatt gccagcattg ctgctaaaga agaaggggta tctctcgaga agagagaggc

     1201 tgaagcatcg atgaattcac gtggcccagc cggccgtctc ggatcggtac ctcgagccgc

     1261 ggcggccgcc agctttctag aacaaaaact catctcagaa gaggatctga atagcgccgt

     1321 cgaccatcat catcatcatc attgagtttg tagccttaga catgactgtt cctcagttca

     1381 agttgggcac ttacgagaag accggtcttg ctagattcta atcaagagga tgtcagaatg

     1441 ccatttgcct gagagatgca ggcttcattt ttgatacttt tttatttgta acctatatag

     1501 tataggattt tttttgtcat tttgtttctt ctcgtacgag cttgctcctg atcagcctat

     1561 ctcgcagctg atgaatatct tgtggtaggg gtttgggaaa atcattcgag tttgatgttt

     1621 ttcttggtat ttcccactcc tcttcagagt acagaagatt aagtgagacc ttcgtttgtg

     1681 cggatccccc acacaccata gcttcaaaat gtttctactc cttttttact cttccagatt

     1741 ttctcggact ccgcgcatcg ccgtaccact tcaaaacacc caagcacagc atactaaatt

     1801 ttccctcttt cttcctctag ggtgtcgtta attacccgta ctaaaggttt ggaaaagaaa

     1861 aaagagaccg cctcgtttct ttttcttcgt cgaaaaaggc aataaaaatt tttatcacgt

     1921 ttctttttct tgaaattttt ttttttagtt tttttctctt tcagtgacct ccattgatat

     1981 ttaagttaat aaacggtctt caatttctca agtttcagtt tcatttttct tgttctatta

     2041 caactttttt tacttcttgt tcattagaaa gaaagcatag caatctaatc taaggggcgg

     2101 tgttgacaat taatcatcgg catagtatat cggcatagta taatacgaca aggtgaggaa

     2161 ctaaaccatg gccaagttga ccagtgccgt tccggtgctc accgcgcgcg acgtcgccgg

     2221 agcggtcgag ttctggaccg accggctcgg gttctcccgg gacttcgtgg aggacgactt

     2281 cgccggtgtg gtccgggacg acgtgaccct gttcatcagc gcggtccagg accaggtggt

     2341 gccggacaac accctggcct gggtgtgggt gcgcggcctg gacgagctgt acgccgagtg

     2401 gtcggaggtc gtgtccacga acttccggga cgcctccggg ccggccatga ccgagatcgg

     2461 cgagcagccg tgggggcggg agttcgccct gcgcgacccg gccggcaact gcgtgcactt

     2521 cgtggccgag gagcaggact gacacgtccg acggcggccc acgggtccca ggcctcggag

     2581 atccgtcccc cttttccttt gtcgatatca tgtaattagt tatgtcacgc ttacattcac

     2641 gccctccccc cacatccgct ctaaccgaaa aggaaggagt tagacaacct gaagtctagg

     2701 tccctattta tttttttata gttatgttag tattaagaac gttatttata tttcaaattt

     2761 ttcttttttt tctgtacaga cgcgtgtacg catgtaacat tatactgaaa accttgcttg

     2821 agaaggtttt gggacgctcg aaggctttaa tttgcaagct ggagaccaac atgtgagcaa

     2881 aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc

     2941 tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga

     3001 caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc

     3061 cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt

     3121 ctcaatgctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct

     3181 gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg

     3241 agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta

     3301 gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct

     3361 acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa

     3421 gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt

     3481 gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta

     3541 cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagatc


No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
