pPICZB Plasmid


  • Model: PVT4005
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pPICZB,Plasmid pPICZB,pPICZB vector


pPICZB Information

Promoter: AOX1 promoter

Replicon: ori

Terminator: CYC1

Plasmid size: 3328bp

Plasmid label: C-Myc, C-His

Prokaryotic resistance: Zeo

Screening markers: Zeo

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression host: yeast cells

5'sequencing primers: AOX5:GACTGGTTCCAATTGACAAGC

3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT

Use: Yeast expression


pPICZB Description
PPICZ A, B and C are 3.3 KB Pichia pastoris protein carriers. The recombinant protein is a fusion protein containing a C- terminal polypeptide, which is too heavy to contain c-myc and C-His tags. The carrier can be used in Pichia pastoris by using methanol to express the high level of the target protein, and can be used in any Pichia pastoris, including X33, GS115 strain, SMD1168H, KM71H. PPICZ features: the 1.5'fragment contains the strict regulation of AOX1 promoter. Using methanol to induce the expression of any 2.Zeocin resistant gene of the gene of interest in Escherichia coli and Pichia pastoris can be used to screen the 3.C- terminal Myc and His tags, and can be used to detect and purify the recombinant protein 4.pPICZ A, B, C, three read code frames that enable the gene to be the gene. Cloned into the carrier without any mutation of the code.


pPICZB Sequence

LOCUS       Exported                3328 bp ds-DNA     circular SYN 10-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 3
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3328)
  TITLE     Direct Submission
FEATURES             Location/Qualifiers
     source          1..3328
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        2..940
                     /gene="Pichia pastoris AOX1"
                     /note="AOX1 promoter"
                     /note="inducible promoter, regulated by methanol"
     CDS             1010..1039
                     /product="Myc (human c-Myc oncogene) epitope tag"
     CDS             1055..1072
                     /product="6xHis affinity tag"
     terminator      1152..1398
                     /gene="Pichia pastoris AOX1"
                     /note="AOX1 terminator"
                     /note="transcription terminator for AOX1"
     promoter        1413..1824
                     /gene="S. cerevisiae TEF1"
                     /note="TEF1 promoter"
                     /note="promoter for EF-1-alpha"
     promoter        1832..1879
                     /note="EM7 promoter"
                     /note="synthetic bacterial promoter "
     CDS             1898..2272
                     /gene="Sh ble from Streptoalloteichus hindustanus"
                     /product="antibiotic-binding protein"
                     /note="confers resistance to bleomycin, phleomycin, and 
     terminator      2338..2585
                     /gene="S. cerevisiae CYC1"
                     /note="CYC1 terminator"
                     /note="transcription terminator for CYC1"
     rep_origin      complement(2660..3248)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag
       61 gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt
      121 tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc
      181 agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta
      241 acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta
      301 tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg
      361 agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct
      421 gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg
      481 ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcggca taccgtttgt
      541 cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct
      601 ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct
      661 ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact
      721 gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat
      781 atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt
      841 actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga
      901 caacttgaga agatcaaaaa acaactaatt attcgaaacg aggaattcac gtggcccagc
      961 cggccgtctc ggatcggtac ctcgagccgc ggcggccgcc agctttctag aacaaaaact
     1021 catctcagaa gaggatctga atagcgccgt cgaccatcat catcatcatc attgagtttg
     1081 tagccttaga catgactgtt cctcagttca agttgggcac ttacgagaag accggtcttg
     1141 ctagattcta atcaagagga tgtcagaatg ccatttgcct gagagatgca ggcttcattt
     1201 ttgatacttt tttatttgta acctatatag tataggattt tttttgtcat tttgtttctt
     1261 ctcgtacgag cttgctcctg atcagcctat ctcgcagctg atgaatatct tgtggtaggg
     1321 gtttgggaaa atcattcgag tttgatgttt ttcttggtat ttcccactcc tcttcagagt
     1381 acagaagatt aagtgagacc ttcgtttgtg cggatccccc acacaccata gcttcaaaat
     1441 gtttctactc cttttttact cttccagatt ttctcggact ccgcgcatcg ccgtaccact
     1501 tcaaaacacc caagcacagc atactaaatt ttccctcttt cttcctctag ggtgtcgtta
     1561 attacccgta ctaaaggttt ggaaaagaaa aaagagaccg cctcgtttct ttttcttcgt
     1621 cgaaaaaggc aataaaaatt tttatcacgt ttctttttct tgaaattttt ttttttagtt
     1681 tttttctctt tcagtgacct ccattgatat ttaagttaat aaacggtctt caatttctca
     1741 agtttcagtt tcatttttct tgttctatta caactttttt tacttcttgt tcattagaaa
     1801 gaaagcatag caatctaatc taaggggcgg tgttgacaat taatcatcgg catagtatat
     1861 cggcatagta taatacgaca aggtgaggaa ctaaaccatg gccaagttga ccagtgccgt
     1921 tccggtgctc accgcgcgcg acgtcgccgg agcggtcgag ttctggaccg accggctcgg
     1981 gttctcccgg gacttcgtgg aggacgactt cgccggtgtg gtccgggacg acgtgaccct
     2041 gttcatcagc gcggtccagg accaggtggt gccggacaac accctggcct gggtgtgggt
     2101 gcgcggcctg gacgagctgt acgccgagtg gtcggaggtc gtgtccacga acttccggga
     2161 cgcctccggg ccggccatga ccgagatcgg cgagcagccg tgggggcggg agttcgccct
     2221 gcgcgacccg gccggcaact gcgtgcactt cgtggccgag gagcaggact gacacgtccg
     2281 acggcggccc acgggtccca ggcctcggag atccgtcccc cttttccttt gtcgatatca
     2341 tgtaattagt tatgtcacgc ttacattcac gccctccccc cacatccgct ctaaccgaaa
     2401 aggaaggagt tagacaacct gaagtctagg tccctattta tttttttata gttatgttag
     2461 tattaagaac gttatttata tttcaaattt ttcttttttt tctgtacaga cgcgtgtacg
     2521 catgtaacat tatactgaaa accttgcttg agaaggtttt gggacgctcg aaggctttaa
     2581 tttgcaagct ggagaccaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa
     2641 aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc
     2701 gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc
     2761 ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
