pPR3- N


  • Model: PVT11260
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT11260
Packing 2ug


pPR3-N Information
Function yeast Hybrid plasmid

Promoter: CYC1 promoter

Replicator: pUC ori, F1 ori, 2 mu ori

Terminator: CYC1 Terminator

Plasmid classification: yeast cell plasmids, yeast hybrid plasmids, two hybrid plasmids.

Plasmid size: 6200bp

Plasmid label: N-NubG; N-HA

Prokaryotic resistance: ampicillin Amp

Screening markers: TRP1

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, LB, aerobic

Expression host: yeast

Culture conditions: 30 centigrade, YPD, aerobic

5'sequencing primers: CYC1-F:CTTTCCTTATACATTAGGACC

3'sequencing primers: CYC1-R:GGGACCTAGACTTCAGGTTG

Note: high copy plasmids


pPR3-N Description

PPR3-N is a plasmid for yeast two hybrid experiment of membrane proteins.The DUALmembrane system is intended for the detection and identification of interactions involving integral membrane proteins and membrane-associated proteins in yeast. The DUALmembrane pairwise interaction kit enables you to: Investigate the interaction between a membrane protein (integral or membrane-associated) and a membrane protein or soluble protein Map domains or amino acids which are critical for an interaction Screen cDNA libraries using a membrane protein as a bait to find novel interacting proteins (requires purchase of a separate cDNA library from Dualsystems)



pPR3-N Sequence

LOCUS       Exported                6200 bp ds-DNA     circular SYN 17-SEP-2017

DEFINITION  synthetic circular DNA


SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 6200)

  AUTHORS   yin

  TITLE     Direct Submission

  JOURNAL   Exported Sep 17, 2017

FEATURES             Location/Qualifiers

     source          1..6200

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     misc_feature    64..360

                     /label=CYC1 promoter

     misc_feature    367..369


     CDS             487..513


                     /product="HA (human influenza hemagglutinin) epitope tag"



     misc_feature    514..623


     terminator      630..881

                     /gene="S. cerevisiae CYC1"

                     /label=CYC1 terminator

                     /note="transcription terminator for CYC1"

     rep_origin      1081..1536


                     /label=f1 ori

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"

     CDS             complement(1634..2308)


                     /gene="S. cerevisiae TRP1"

                     /product="phosphoribosylanthranilate isomerase, required 

                     for tryptophan biosynthesis"


                     /note="yeast auxotrophic marker"






     promoter        complement(2309..2589)

                     /gene="S. cerevisiae TRP1"

                     /label=TRP1 promoter

     rep_origin      2844..4186

                     /label=2u ori

                     /note="yeast 2u plasmid origin of replication"

     promoter        4213..4317


                     /label=AmpR promoter

     CDS             4318..5178





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     rep_origin      5349..5937



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


ORIGIN(For reference)

        1 gccgcggatg attacgccaa gcgcgcaatt aaccctcact aaagggaaca aaagctggag

       61 ctctcatttg gcgagcgttg gttggtggat caagcccacg cgtaggcaat cctcgagcag

      121 atccgccagg cgtgtatata tagcgtggat ggccaggcaa ctttagtgct gacacataca

      181 ggcatatata tatgtgtgcg acgacacatg atcatatggc atgcatgtgc tctgtatgta

      241 tataaaactc ttgttttctt cttttctcta aatattcttt ccttatacat taggaccttt

      301 gcagcataaa ttactatact tctatagaca cgcaaacaca aatacacaca ctaatctaga

      361 actagtatgc agattttcgt caagactttg accggtaaaa ccggaacatt ggaagttgaa

      421 tcttccgata ccatcgacaa cgttaagtcg aaaattcaag acaaggaagg aatccctggt

      481 ggtccatacc catacgatgt tccagattac gctggatcca agcagtggta tcaacgcaga

      541 gtggccatta cggcccggga aaaaacatgt cggccgcctc ggcctctcga gaattcgata

      601 tcaagcttat cgataccgtc gacctcgagt catgtaatta gttatgtcac gcttacattc

      661 acgccctccc cccacatccg ctctaaccga aaaggaagga gttagacaac ctgaagtcta

      721 ggtccctatt tattttttta tagttatgtt agtattaaga acgttattta tatttcaaat

      781 ttttcttttt tttctgtaca gacgcgtgta cgcatgtaac attatactga aaaccttgct

      841 tgagaaggtt ttgggacgct cgaaggcttt aatttgcggc cggtacccaa ttcgccctat

      901 agtgagtcgt attacgcgcg ctcactggcc gtcgttttac aacgtcgtga ctgggaaaac

      961 cctggcgtta cccaacttaa tcgccttgca gcacatcccc ctttcgccag ctggcgtaat

     1021 agcgaagagg cccgcaccga tcgcccttcc caacagttgc gcagcctgaa tggcgaatgg

     1081 acgcgccctg tagcggcgca ttaagcgcgg cgggtgtggt ggttacgcgc agcgtgaccg

     1141 ctacacttgc cagcgcccta gcgcccgctc ctttcgcttt cttcccttcc tttctcgcca

     1201 cgttcgccgg ctttccccgt caagctctaa atcgggggct ccctttaggg ttccgattta

     1261 gtgctttacg gcacctcgac cccaaaaaac ttgattaggg tgatggttca cgtagtgggc

     1321 catcgccctg atagacggtt tttcgccctt tgacgttgga gtccacgttc tttaatagtg

     1381 gactcttgtt ccaaactgga acaacactca accctatctc ggtctattct tttgatttat

     1441 aagggatttt gccgatttcg gcctattggt taaaaaatga gctgatttaa caaaaattta

     1501 acgcgaattt taacaaaata ttaacgttta caatttcctg atgcgtattt tctccttacg

     1561 catctgtgcg gtatttcaca ccgcataggc aagtgcacaa acaatactta aataaatact

     1621 actcagtaat aacctatttc ttagcatttt tgacgaaatt tgctattttg ttagagtctt

     1681 ttacaccatt tgtctccaca cctccgctta catcaacacc aataacgcca tttaatctaa

     1741 gcgcatcacc aacattttct ggcgtcagtc caccagctaa cataaaatgt aagctttcgg

     1801 ggctctcttg ccttccaacc cagtcagaaa tcgagttcca atccaaaagt tcacctgtcc

     1861 cacctgcttc tgaatcaaac aagggaataa acgaatgagg tttctgtgaa gctgcactga

     1921 gtagtatgtt gcagtctttt ggaaatacga gtcttttaat aactggcaaa ccgaggaact

     1981 cttggtattc ttgccacgac tcatctccat gcagttggac gatatcaatg ccgtaatcat

     2041 tgaccagagc caaaacatcc tccttaggtt gattacgaaa cacgccaacc aagtatttcg

     2101 gagtgcctga actattttta tatgctttta caagacttga aattttcctt gcaataaccg

     2161 ggtcaattgt tctctttcta ttgggcacac atataatacc cagcaagtca gcatcggaat

     2221 ctagagcaca ttctgcggcc tctgtgctct gcaagccgca aactttcacc aatggaccag

     2281 aactacctgt gaaattaata acagacatac tccaagctgc ctttgtgtgc ttaatcacgt

     2341 atactcacgt gctcaatagt caccaatgcc ctccctcttg gccctctcct tttctttttt

     2401 cgaccgaatt aattcttaat cggcaaaaaa agaaaagctc cggatcaaga ttgtacgtaa

     2461 ggtgacaagc tatttttcaa taaagaatat cttccactac tgccatctgg cgtcataact

     2521 gcaaagtaca catatattac gatgctgtct attaaatgct tcctatatta tatatatagt

     2581 aatgtcgttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc

     2641 cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg

     2701 cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat

     2761 caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca

     2821 tgataataat ggtttcttaa tatgatccaa tatcaaagga aatgatagca ttgaaggatg

     2881 agactaatcc aattgaggag tggcagcata tagaacagct aaagggtagt gctgaaggaa

     2941 gcatacgata ccccgcatgg aatgggataa tatcacagga ggtactagac tacctttcat

     3001 cctacataaa tagacgcata taagtacgca tttaagcata aacacgcact atgccgttct

     3061 tctcatgtat atatatatac aggcaacacg cagatatagg tgcgacgtga acagtgagct

     3121 gtatgtgcgc agctcgcgtt gcattttcgg aagcgctcgt tttcggaaac gctttgaagt

     3181 tcctattccg aagttcctat tctctagaaa gtataggaac ttcagagcgc ttttgaaaac

     3241 caaaagcgct ctgaagacgc actttcaaaa aaccaaaaac gcaccggact gtaacgagct

     3301 actaaaatat tgcgaatacc gcttccacaa acattgctca aaagtatctc tttgctatat

     3361 atctctgtgc tatatcccta tataacctac ccatccacct ttcgctcctt gaacttgcat

     3421 ctaaactcga cctctacatt ttttatgttt atctctagta ttactcttta gacaaaaaaa

     3481 ttgtagtaag aactattcat agagtgaatc gaaaacaata cgaaaatgta aacatttcct

     3541 atacgtagta tatagagaca aaatagaaga aaccgttcat aattttctga ccaatgaaga

     3601 atcatcaacg ctatcacttt ctgttcacaa agtatgcgca atccacatcg gtatagaata

     3661 taatcgggga tgcctttatc ttgaaaaaat gcacccgcag cttcgctagt aatcagtaaa

     3721 cgcgggaagt ggagtcaggc tttttttatg gaagagaaaa tagacaccaa agtagccttc

     3781 ttctaacctt aacggaccta cagtgcaaaa agttatcaag agactgcatt atagagcgca

     3841 caaaggagaa aaaaagtaat ctaagatgct ttgttagaaa aatagcgctc tcgggatgca

     3901 tttttgtaga acaaaaaaga agtatagatt ctttgttggt aaaatagcgc tctcgcgttg

     3961 catttctgtt ctgtaaaaat gcagctcaga ttctttgttt gaaaaattag cgctctcgcg

     4021 ttgcattttt gttttacaaa aatgaagcac agattcttcg ttggtaaaat agcgctttcg

     4081 cgttgcattt ctgttctgta aaaatgcagc tcagattctt tgtttgaaaa attagcgctc

     4141 tcgcgttgca tttttgttct acaaaatgaa gcacagatgc ttcgttcagg tggcactttt

     4201 cggggaaatg tgcgcggaac ccctatttgt ttatttttct aaatacattc aaatatgtat

     4261 ccgctcatga gacaataacc ctgataaatg cttcaataat attgaaaaag gaagagtatg

     4321 agtattcaac atttccgtgt cgcccttatt cccttttttg cggcattttg ccttcctgtt

     4381 tttgctcacc cagaaacgct ggtgaaagta aaagatgctg aagatcagtt gggtgcacga

     4441 gtgggttaca tcgaactgga tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa

     4501 gaacgttttc caatgatgag cacttttaaa gttctgctat gtggcgcggt attatcccgt

     4561 attgacgccg ggcaagagca actcggtcgc cgcatacact attctcagaa tgacttggtt

     4621 gagtactcac cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc

     4681 agtgctgcca taaccatgag tgataacact gcggccaact tacttctgac aacgatcgga

     4741 ggaccgaagg agctaaccgc ttttttgcac aacatggggg atcatgtaac tcgccttgat

     4801 cgttgggaac cggagctgaa tgaagccata ccaaacgacg agcgtgacac cacgatgcct

     4861 gtagcaatgg caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc

     4921 cggcaacaat taatagactg gatggaggcg gataaagttg caggaccact tctgcgctcg

     4981 gcccttccgg ctggctggtt tattgctgat aaatctggag ccggtgagcg tgggtctcgc

     5041 ggtatcattg cagcactggg gccagatggt aagccctccc gtatcgtagt tatctacacg

     5101 acggggagtc aggcaactat ggatgaacga aatagacaga tcgctgagat aggtgcctca

     5161 ctgattaagc attggtaact gtcagaccaa gtttactcat atatacttta gattgattta

     5221 aaacttcatt tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc

     5281 aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa

     5341 ggatcttctt gagatccttt ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca

     5401 ccgctaccag cggtggtttg tttgccggat caagagctac caactctttt tccgaaggta

     5461 actggcttca gcagagcgca gataccaaat actgtccttc tagtgtagcc gtagttaggc

     5521 caccacttca agaactctgt agcaccgcct acatacctcg ctctgctaat cctgttacca

     5581 gtggctgctg ccagtggcga taagtcgtgt cttaccgggt tggactcaag acgatagtta

     5641 ccggataagg cgcagcggtc gggctgaacg gggggttcgt gcacacagcc cagcttggag

     5701 cgaacgacct acaccgaact gagataccta cagcgtgagc tatgagaaag cgccacgctt

     5761 cccgaaggga gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc

     5821 acgagggagc ttccaggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac

     5881 ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac

     5941 gccagcaacg cggcttttta cggttcctgg ccttttgctg gccttttgct cacatgttct

     6001 ttcctgcgtt atcccctgat tctgtggata accgtattac cgcctttgag tgagctgata

     6061 ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa gcggaagagc

     6121 gcccaatacg caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctggcacg

     6181 acaggtttcc cgactggaaa



Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
