
  • Model: PVT0373
  • 500 Units in Stock
Ask a question

Add to Cart:


PVT0373   2ug

pProEX HTA Infomation

Plasmid type: expression of Escherichia coli

Expression level: high

Cloning methods: polyclonal sites, restrictive endonucleases

Carrier size: 4751bp

Sequence primer sequence of 5'sequencing: M13/pUC Reverse: AGCGGATAACAATTTCACACAGG (Invitrogen)

Sequence primer sequence of 3'sequencing: pTrcHis Reverse: GATTTAATCTGTATCAGG (Invitrogen)

Carrier label: N-His, N-TEV protease cutting site

Carrier resistance: ampicin


Hosts: E.coli. Related vectors: pBR322.

Product directory number: 50609

Stability: instantaneous expression of Transient

Composition / inducible type: inducible type

Virus / non virus: non virus

pProEX HTA Description
pProEX HT series prokaryotic expression system is a carrier used to express foreign proteins in Escherichia coli. The target protein expressed by this carrier contains 6 His purify labels. The target gene can be cloned into the polyclonal site of the vector. After the expression of pProEX HTa, B and C. protein is selected, the His purification tag is located at the N end of the target protein. Meanwhile, the use of His purification tag can be used for protein purification. The rTEV protease identification site is also contained on the carrier, and the rTEV protease can be used for enzyme digestion to remove the fused His label.


pProEX HTA Sequence

LOCUS       pPROEX HTa    4751 bp     DNA    circular     SYN
  ORGANISM  other sequences; artificial sequences; vectors.
FEATURES             Location/Qualifiers
     source          1..4751
                     /organism="pPROEX HTa"
                     /mol_type="other DNA"
     promoter        193..266
     misc_feature    235..257
     misc_feature    complement(472..489)
     misc_feature    complement(472..489)
     terminator      522..679
     terminator      645..688
     terminator      820..847
     promoter        889..917
     gene            959..1819
     CDS             959..1819
                     /label="ORF frame 2"
     rep_origin      1974..2593
     rep_origin      complement(2931..3237)
     misc_feature    3452..3474
     misc_feature    3621..4712
     CDS             3753..4712
                     /label="ORF frame 3"

Product is for research use only!


Search name

pProEX HTA,Plasmid pProEX HTA,pProEX HTA vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
