
  • Model: PVT0374
  • 48 Units in Stock
Ask a question

Add to Cart:


PVT0374   2ug


pProEX HTB Informaiton

Promoter: T7/lac

Replicator: ColE1 ori, F1 ori

Terminator: rrnB T1 Terminator

Plasmid classification: large intestine plasmid; large intestine expression plasmid; pET series plasmid.

Plasmid size: 4779bp

Plasmid label: N-6 x His, N-TEV

Prokaryotic resistance: ampicillin Amp (100 u g/ml)

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression of host: BL21 (DE3) and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: M13/pUC everse-F (AGCGGATAACAATTTCACACAGG)

3'sequencing primers: pTrcHis Reverse-R (GATTTAATCTGTATCAGG)

Note: His, rTEV protease cutting site


pProEX HTB Description

pProEXHTB plasmid is a prokaryotic expression vector, and the N terminal contains a 6 x His tag and a TEV locus. The plasmid contains several commonly used restriction sites to facilitate cloning of different genes.

PProEX HT prokaryotic expression plasmid is used to express foreign protein in E. coli. The target protein expressed by this plasmid contains 6 His purification labels. The target gene can be cloned to the polyclonal loci of the carrier. After the expression of pProEX HTa, B, C. protein, the His purification label is located at the N end of the target protein, and the use of His purification label can be used for protein purification. The vector contains rTEV protease recognition sites, which can be digested by rTEV protease, thus removing the fused His tag.



pProEX HTB Sequence

LOCUS Exported 4779 bp ds-DNA circular SYN 27-8-2015
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 4779)
TITLE Direct Submission
JOURNAL Exported 2015-8-27
FEATURES Location/Qualifiers
source 1..4779
/organism="synthetic DNA construct"
/mol_type="other DNA"
protein_bind 230..246
/bound_moiety="lac repressor encoded by lacI"
/note="lac operator"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
CDS 279..296
/product="6xHis affinity tag"
CDS 318..338
/product="tobacco etch virus (TEV) protease recognition and
cleavage site"
/note="TEV Site"
terminator 643..729
/gene="Escherichia coli rrnB"
/note="rrnB T1 terminator"
/note="transcription terminator T1 from the E. coli rrnB
terminator 821..848
/note="rrnB T2 terminator"
/note="transcription terminator T2 from the E. coli rrnB
promoter 868..959
/note="AmpR promoter"
CDS 960..1820
/note="confers resistance to ampicillin, carbenicillin, and
related antibiotics"
rep_origin 1991..2579
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
rep_origin complement(2827..3255)
/note="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 3580..3657
/gene="lacI (mutant)"
/note="lacIq promoter"
/note="In the lacIq allele, a single base change in the
promoter boosts expression of the lacI gene about 10-fold."
CDS 3658..4740
/product="lac repressor"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
1 gtttgacagc ttatcatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc
61 ggaagctgtg gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc
121 gcactcccgt tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc
181 tgaaatgagc tgttgacaat taatcatccg gtccgtataa tctgtggaat tgtgagcgga
241 taacaatttc acacaggaaa cagaccatgt cgtactacca tcaccatcac catcacgatt
301 acgatatccc aacgaccgaa aacctgtatt ttcagggcgc catgggatcc ggaattcaaa
361 ggcctacgtc gacgagctca ctagtcgcgg ccgctttcga atctagagcc tgcagtctcg
421 aggcatgcgg taccaagctt ggctgttttg gcggatgaga gaagattttc agcctgatac
481 agattaaatc agaacgcaga agcggtctga taaaacagaa tttgcctggc ggcagtagcg
541 cggtggtccc acctgacccc atgccgaact cagaagtgaa acgccgtagc gccgatggta
601 gtgtggggtc tccccatgcg agagtaggga actgccaggc atcaaataaa acgaaaggct
661 cagtcgaaag actgggcctt tcgttttatc tgttgtttgt cggtgaacgc tctcctgagt
721 aggacaaatc cgccgggagc ggatttgaac gttgcgaagc aacggcccgg agggtggcgg
781 gcaggacgcc cgccataaac tgccaggcat caaattaagc agaaggccat cctgacggat
841 ggcctttttg cgtttctaca aactcttttt gtttattttt ctaaatacat tcaaatatgt
901 atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa aggaagagta
961 tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt tgccttcctg
1021 tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag ttgggtgcac
1081 gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt tttcgccccg
1141 aagaacgttt tccaatgatg agcactttta aagttctgct atgtggcgcg gtattatccc
1201 gtgttgacgc cgggcaagag caactcggtc gccgcataca ctattctcag aatgacttgg
1261 ttgagtactc accagtcaca gaaaagcatc ttacggatgg catgacagta agagaattat
1321 gcagtgctgc cataaccatg agtgataaca ctgcggccaa cttacttctg acaacgatcg
1381 gaggaccgaa ggagctaacc gcttttttgc acaacatggg ggatcatgta actcgccttg
1441 atcgttggga accggagctg aatgaagcca taccaaacga cgagcgtgac accacgatgc
1501 ctacagcaat ggcaacaacg ttgcgcaaac tattaactgg cgaactactt actctagctt
1561 cccggcaaca attaatagac tggatggagg cggataaagt tgcaggacca cttctgcgct
1621 cggcccttcc ggctggctgg tttattgctg ataaatctgg agccggtgag cgtgggtctc
1681 gcggtatcat tgcagcactg gggccagatg gtaagccctc ccgtatcgta gttatctaca
1741 cgacggggag tcaggcaact atggatgaac gaaatagaca gatcgctgag ataggtgcct
1801 cactgattaa gcattggtaa ctgtcagacc aagtttactc atatatactt tagattgatt
1861 taaaacttca tttttaattt aaaaggatct aggtgaagat cctttttgat aatctcatga
1921 ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta gaaaagatca
1981 aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac
2041 caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt tttccgaagg
2101 taactggctt cagcagagcg cagataccaa atactgtcct tctagtgtag ccgtagttag
2161 gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta atcctgttac
2221 cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca agacgatagt
2281 taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag cccagcttgg
2341 agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa agcgccacgc
2401 ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga acaggagagc
2461 gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc
2521 acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa
2581 acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt gctcacatgt
2641 tctttcctgc gttatcccct gattctgtgg ataaccgtat taccgccttt gagtgagctg
2701 ataccgctcg ccgcagccga acgaccgagc gcagcgagtc agtgagcgag gaagcggaag
2761 agcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcataattt
2821 tgttaaaatt cgcgttaaat ttttgttaaa tcagctcatt ttttaaccaa taggccgaaa
2881 tcggcaaaat cccttataaa tcaaaagaat agaccgagat agggttgagt gttgttccag
2941 tttggaacaa gagtccacta ttaaagaacg tggactccaa cgtcaaaggg cgaaaaaccg
3001 tctatcaggg cgatggccca ctacgtgaac catcacccta atcaagtttt ttggggtcga
3061 ggtgccgtaa agcactaaat cggaacccta aagggagccc ccgatttaga gcttgacggg
3121 gaaagccggc gaacgtggcg agaaaggaag ggaagaaagc gaaaggagcg ggcgctaggg
3181 cgctggcaag tgtagcggtc acgctgcgcg taaccaccac acccgccgcg cttaatgcgc
3241 cgctacaggg cgcgtcccat tcgccattca ggctgctatg gtgcactctc agtacaatct
3301 gctctgatgc cgcatagtta agccagtacc agtcacgtag cgatatcgga gtgtatacac
3361 tccgctatcg ctacgtgact gggtcatggc tgcgccccga cacccgccaa cacccgctga
3421 cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc
3481 cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga ggcagcagat
3541 caattcgcgc gcgaaggcga agcggcatgc atttacgttg acaccatcga atggtgcaaa
3601 acctttcgcg gtatggcatg atagcgcccg gaagagagtc aattcagggt ggtgaatgtg
3661 aaaccagtaa cgttatacga tgtcgcagag tatgccggtg tctcttatca gaccgtttcc
3721 cgcgtggtga accaggccag ccacgtttct gcgaaaacgc gggaaaaagt ggaagcggcg
3781 atggcggagc tgaattacat tcccaaccgc gtggcacaac aactggcggg caaacagtcg
3841 ttgctgattg gcgttgccac ctccagtctg gccctgcacg cgccgtcgca aattgtcgcg
3901 gcgattaaat ctcgcgccga tcaactgggt gccagcgtgg tggtgtcgat ggtagaacga
3961 agcggcgtcg aagcctgtaa agcggcggtg cacaatcttc tcgcgcaacg cgtcagtggg
4021 ctgatcatta actatccgct ggatgaccag gatgccattg ctgtggaagc tgcctgcact
4081 aatgttccgg cgttatttct tgatgtctct gaccagacac ccatcaacag tattattttc
4141 tcccatgaag acggtacgcg actgggcgtg gagcatctgg tcgcattggg tcaccagcaa
4201 atcgcgctgt tagcgggccc attaagttct gtctcggcgc gtctgcgtct ggctggctgg
4261 cataaatatc tcactcgcaa tcaaattcag ccgatagcgg aacgggaagg cgactggagt
4321 gccatgtccg gttttcaaca aaccatgcaa atgctgaatg agggcatcgt tcccactgcg
4381 atgctggttg ccaacgatca gatggcgctg ggcgcaatgc gcgccattac cgagtccggg
4441 ctgcgcgttg gtgcggatat ctcggtagtg ggatacgacg ataccgaaga cagctcatgt
4501 tatatcccgc cgttaaccac catcaaacag gattttcgcc tgctggggca aaccagcgtg
4561 gaccgcttgc tgcaactctc tcagggccag gcggtgaagg gcaatcagct gttgcccgtc
4621 tcactggtga aaagaaaaac caccctggca cccaatacgc aaaccgcctc tccccgcgcg
4681 ttggccgatt cattaatgca gctggcacga caggtttccc gactggaaag cgggcagtga
4741 gcgcaacgca attaatgtga gttagcgcga attgatctg

*Product is for research use only

Search name

pProEX HTB,Plasmid pProEX HTB,pProEX HTB vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
