
  • Model: PVT0375
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0375      2ug


pProEX HTC Information

Promoter: T7/lac

Replicator: ColE1 ori, F1 ori

Terminator: rrnB T1 Terminator

Plasmid classification: Escherichia coli vector; PET series expression plasmid

Plasmid size: 4779bp

Plasmid label: N-6 x His, N-TEV

Prokaryotic resistance: ampicillin Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: BL21 (DE3)

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: T7:TAATACGACTCACTATAGGG


pProEX HTC Decription

The prokaryotic expression system of pProEX HT series is used to express foreign proteins in E. coli. The target protein expressed by this vector contains 6 His purification labels. The target gene can be cloned to the polyclonal loci of the carrier. After the expression of pProEX HTa, B, C. protein, the His purification label is located at the N end of the target protein, and the use of His purification label can be used for protein purification. The vector contains rTEV protease recognition sites, which can be digested by rTEV protease, thus removing the fused His tag.


pProEX HTC Sequence

LOCUS       Exported                4779 bp ds-DNA    circular SYN 27-8-2015
KEYWORDS    Untitled 2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4779)
  AUTHORS   admin
  TITLE     Direct Submission
  JOURNAL   Exported 2015-8-27
FEATURES             Location/Qualifiers
     source          1..4779
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     protein_bind    230..246
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             279..296
                     /product="6xHis affinity tag"
     CDS             318..338
                     /product="tobacco etch virus (TEV) protease recognition and
                     cleavage site"
                     /note="TEV Site"
     terminator      644..730
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      822..849
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB
     promoter        869..960
                     /note="AmpR promoter"
     CDS             961..1821
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      1992..2580
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     rep_origin      complement(2828..3256)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        3581..3658
                     /gene="lacI (mutant)"
                     /note="lacIq promoter"
                     /note="In the lacIq allele, a single base change in the
                     promoter boosts expression of the lacI gene about 10-fold."
     CDS             3659..4741
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
        1 gtttgacagc ttatcatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc
       61 ggaagctgtg gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc
      121 gcactcccgt tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc
      181 tgaaatgagc tgttgacaat taatcatccg gtccgtataa tctgtggaat tgtgagcgga
      241 taacaatttc acacaggaaa cagaccatgt cgtactacca tcaccatcac catcacgatt
      301 acgatatccc aacgaccgaa aacctgtatt ttcagggcgc catggggatc cggaattcaa
      361 aggcctacgt cgacgagctc actagtcgcg gccgctttcg aatctagagc ctgcagtctc
      421 gaggcatgcg gtaccaagct tggctgtttt ggcggatgag agaagatttt cagcctgata
      481 cagattaaat cagaacgcag aagcggtctg ataaaacaga atttgcctgg cggcagtagc
      541 gcggtggtcc cacctgaccc catgccgaac tcagaagtga aacgccgtag cgccgatggt
      601 agtgtggggt ctccccatgc gagagtaggg aactgccagg catcaaataa aacgaaaggc
      661 tcagtcgaaa gactgggcct ttcgttttat ctgttgtttg tcggtgaacg ctctcctgag
      721 taggacaaat ccgccgggag cggatttgaa cgttgcgaag caacggcccg gagggtggcg
      781 ggcaggacgc ccgccataaa ctgccaggca tcaaattaag cagaaggcca tcctgacgga
      841 tggccttttt gcgtttctac aaactctttt tgtttatttt tctaaataca ttcaaatatg
      901 tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt
      961 atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct
     1021 gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca
     1081 cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc
     1141 gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc
     1201 cgtgttgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg
     1261 gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta
     1321 tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc
     1381 ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt
     1441 gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg
     1501 cctacagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct
     1561 tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc
     1621 tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct
     1681 cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac
     1741 acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc
     1801 tcactgatta agcattggta actgtcagac caagtttact catatatact ttagattgat
     1861 ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg
     1921 accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc
     1981 aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa
     2041 ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag
     2101 gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta
     2161 ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta
     2221 ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag
     2281 ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg
     2341 gagcgaacga cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg
     2401 cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag
     2461 cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc
     2521 cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa
     2581 aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacatg
     2641 ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt tgagtgagct
     2701 gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa
     2761 gagcgcctga tgcggtattt tctccttacg catctgtgcg gtatttcaca ccgcataatt
     2821 ttgttaaaat tcgcgttaaa tttttgttaa atcagctcat tttttaacca ataggccgaa
     2881 atcggcaaaa tcccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca
     2941 gtttggaaca agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc
     3001 gtctatcagg gcgatggccc actacgtgaa ccatcaccct aatcaagttt tttggggtcg
     3061 aggtgccgta aagcactaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg
     3121 ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg
     3181 gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg
     3241 ccgctacagg gcgcgtccca ttcgccattc aggctgctat ggtgcactct cagtacaatc
     3301 tgctctgatg ccgcatagtt aagccagtat acactccaat attgctacgt gactggtaca
     3361 ctccgctatc gctacgtgac tgggtcatgg ctgcgccccg acacccgcca acacccgctg
     3421 acgcgccctg acgggcttgt ctgctcccgg catccgctta cagacaagct gtgaccgtct
     3481 ccgggagctg catgtgtcag aggttttcac cgtcatcacc gaaacgcgcg aggcagcaga
     3541 tcaattcgcg cgcgaaggcg aagcggcatg catttacgtt gacaccatcg aatggtgcaa
     3601 aacctttcgc ggtatggcat gatagcgccc ggaagagagt caattcaggg tggtgaatgt
     3661 gaaaccagta acgttatacg atgtcgcaga gtatgccggt gtctcttatc agaccgtttc
     3721 ccgcgtggtg aaccaggcca gccacgtttc tgcgaaaacg cgggaaaaag tggaagcggc
     3781 gatggcggag ctgaattaca ttcccaaccg cgtggcacaa caactggcgg gcaaacagtc
     3841 gttgctgatt ggcgttgcca cctccagtct ggccctgcac gcgccgtcgc aaattgtcgc
     3901 ggcgattaaa tctcgcgccg atcaactggg tgccagcgtg gtggtgtcga tggtagaacg
     3961 aagcggcgtc gaagcctgta aagcggcggt gcacaatctt ctcgcgcaac gcgtcagtgg
     4021 gctgatcatt aactatccgc tggatgacca ggatgccatt gctgtggaag ctgcctgcac
     4081 taatgttccg gcgttatttc ttgatgtctc tgaccagaca cccatcaaca gtattatttt
     4141 ctcccatgaa gacggtacgc gactgggcgt ggagcatctg gtcgcattgg gtcaccagca
     4201 aatcgcgctg ttagcgggcc cattaagttc tgtctcggcg cgtctgcgtc tggctggctg
     4261 gcataaatat ctcactcgca atcaaattca gccgatagcg gaacgggaag gcgactggag
     4321 tgccatgtcc ggttttcaac aaaccatgca aatgctgaat gagggcatcg ttcccactgc
     4381 gatgctggtt gccaacgatc agatggcgct gggcgcaatg cgcgccatta ccgagtccgg
     4441 gctgcgcgtt ggtgcggata tctcggtagt gggatacgac gataccgaag acagctcatg
     4501 ttatatcccg ccgttaacca ccatcaaaca ggattttcgc ctgctggggc aaaccagcgt
     4561 ggaccgcttg ctgcaactct ctcagggcca ggcggtgaag ggcaatcagc tgttgcccgt
     4621 ctcactggtg aaaagaaaaa ccaccctggc acccaatacg caaaccgcct ctccccgcgc
     4681 gttggccgat tcattaatgc agctggcacg acaggtttcc cgactggaaa gcgggcagtg
     4741 agcgcaacgc aattaatgtg agttagcgcg aattgatct

Product is for research use only!


Search name

pProEX HTC,Plasmid pProEX HTC,pProEX HTC vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
