pQE- 100 DoubleTaq Plasmid


  • Model: PVT0540
  • 50 Units in Stock
Ask a question

Add to Cart:

pQE-100 DoubleTaq

Search name

pQE-100 DoubleTaq,Plasmid pQE-100 DoubleTaq,pQE-100 DoubleTaq vector


pQE- 100 DoubleTaq Informaiton

Promoter: T5

Replicon: ColE1 ori

Terminator: Lambda t0 terminator; rrnB T1

Plasmid classification: Escherichia coli vector; pQE series expression plasmid

Plasmid size: 3512bp

Prokaryotic resistance: ampicillin Amp

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic, LB

Expression host: M15

Culture conditions: 37 C, aerobic, LB

Induction: IPTG or lactose and its analogues.

5'sequencing primers: pQE30-F: AGCGGATAACAATTTCACACAG

3'sequencing primers: pQE30-R: TTCTGAGGTCATTACTGGATC


pQE- 100 DoubleTaq Mutiple cloning site




pQE- 100 DoubleTaq Sequence

LOCUS       Exported                3512 bp ds-DNA     circular SYN 05-DEC-2013
DEFINITION  Bacterial vector for expressing proteins with an N-terminal 6xHis
            tag and a C-terminal Tag-100 tag.
KEYWORDS    pQE-100 DoubleTag
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3512)
  AUTHORS   Qiagen
  TITLE     Direct Submission
  JOURNAL   Exported Wednesday, September 14, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..3512
                     /organism="synthetic DNA construct"
                     /lab_host="Escherichia coli"
                     /mol_type="other DNA"
     promoter        10..54
                     /note="T5 promoter"
                     /note="bacteriophage T5 promoter for E. coli RNA
                     polymerase, with embedded lac operator"
     protein_bind    30..46
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    62..78
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     RBS             101..106
                     /note="ribosome binding site"
     CDS             115..117
                     /product="start codon"
     CDS             127..144
                     /product="6xHis affinity tag"
     misc_feature    145..184
                     /note="multiple cloning site"
     CDS             193..228
                     /product="epitope tag derived from MAP kinase 2"
     misc_feature    243..253
                     /note="stop codons"
                     /note="stop codons in all three reading frames"
     terminator      259..353
                     /note="lambda t0 terminator"
                     /note="transcription terminator from phage lambda"
     CDS             397..1056
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     terminator      1121..1207
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     rep_origin      complement(1688..2276)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(2447..3307)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(3308..3412)
                     /note="AmpR promoter"
        1 ctcgagaaat cataaaaaat ttatttgctt tgtgagcgga taacaattat aatagattca
       61 attgtgagcg gataacaatt tcacacagaa ttcattaaag aggagaaatt aactatgaga
      121 ggatcgcatc accatcacca tcacggatcc gcatgcgagc tcggtacccc gggtcgacct
      181 gcagccaagc ttgaagagac tgcacgtttc cagccgggtt atcgttctta gagatctaag
      241 cttaattagc tgagcttgga ctcctgttga tagatccagt aatgacctca gaactccatc
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
