pQE- 12


  • Model: PVT0510
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0510      2ug


pQE-12 Information

Promoter: T5

Replicon: ColE1 ori

Terminator: Lambda t0 terminator; rrnB T1

Plasmid classification: Escherichia coli vector; pQE series expression plasmid

Plasmid size: 3427bp

Prokaryotic resistance: ampicillin Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: M15

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: pQE30-F: AGCGGATAACAATTTCACACAG

3'sequencing primers: pQE30-R: TTCTGAGGTCATTACTGGATC


pQE-12 Description



pQE-12 Sequence

LOCUS       Exported                3427 bp ds-DNA     circular SYN 05-DEC-2013
DEFINITION  Bacterial vector for expressing C-terminally 6xHis-tagged proteins.
            See pQE-70 for an improved version of this vector.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3427)
  AUTHORS   Qiagen
  TITLE     Direct Submission
  JOURNAL   Exported Wednesday, September 14, 2016 from SnapGene Viewer 3.1.4
COMMENT     Discontinued pQE vector.
FEATURES             Location/Qualifiers
     source          1..3427
                     /organism="synthetic DNA construct"
                     /lab_host="Escherichia coli"
                     /mol_type="other DNA"
     promoter        10..54
                     /note="T5 promoter"
                     /note="bacteriophage T5 promoter for E. coli RNA
                     polymerase, with embedded lac operator"
     protein_bind    30..46
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    62..78
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     RBS             101..106
                     /note="ribosome binding site"
     CDS             115..117
                     /product="start codon"
     CDS             133..150
                     /product="6xHis affinity tag"
     misc_feature    157..167
                     /note="stop codons"
                     /note="stop codons in all three reading frames"
     terminator      173..267
                     /note="lambda t0 terminator"
                     /note="transcription terminator from phage lambda"
     CDS             311..970
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     terminator      1035..1121
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     rep_origin      complement(1603..2191)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(2362..3222)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(3223..3327)
                     /note="AmpR promoter"
        1 ctcgagaaat cataaaaaat ttatttgctt tgtgagcgga taacaattat aatagattca
       61 attgtgagcg gataacaatt tcacacagaa ttcattaaag aggagaaatt aactatgaga
      121 ggatccagat ctcatcacca tcaccatcac taagcttaat tagctgagct tggactcctg
      181 ttgatagatc cagtaatgac ctcagaactc catctggatt tgttcagaac gctcggttgc
      241 cgccgggcgt tttttattgg tgagaatcca agctagcttg gcgagatttt caggagctaa
      301 ggaagctaaa atggagaaaa aaatcactgg atataccacc gttgatatat cccaatggca
      361 tcgtaaagaa cattttgagg catttcagtc agttgctcaa tgtacctata accagaccgt
      421 tcagctggat attacggcct ttttaaagac cgtaaagaaa aataagcaca agttttatcc
      481 ggcctttatt cacattcttg cccgcctgat gaatgctcat ccggaatttc gtatggcaat
      541 gaaagacggt gagctggtga tatgggatag tgttcaccct tgttacaccg ttttccatga
      601 gcaaactgaa acgttttcat cgctctggag tgaataccac gacgatttcc ggcagtttct
      661 acacatatat tcgcaagatg tggcgtgtta cggtgaaaac ctggcctatt tccctaaagg
      721 gtttattgag aatatgtttt tcgtctcagc caatccctgg gtgagtttca ccagttttga
      781 tttaaacgtg gccaatatgg acaacttctt cgcccccgtt ttcaccatgg gcaaatatta
      841 tacgcaaggc gacaaggtgc tgatgccgct ggcgattcag gttcatcatg ccgtctgtga
      901 tggcttccat gtcggcagaa tgcttaatga attacaacag tactgcgatg agtggcaggg
      961 cggggcgtaa tttttttaag gcagttattg gtgcccttaa acgcctgggg taatgactct
     1021 ctagcttgag gcatcaaata aaacgaaagg ctcagtcgaa agactgggcc tttcgtttta
     1081 tctgttgttt gtcggtgaac gctctcctga gtaggacaaa tccgccgctc tagagctgcc
     1141 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     1201 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     1261 ttggcgggtg tcggggcgca gccatgaccc agtcacgtag cgatagcgga gtgtatactg
     1321 gcttaactat gcggcatcag agcagattgt actgagagtg caccatatgc ggtgtgaaat
     1381 accgcacaga tgcgtaagga gaaaataccg catcaggcgc tcttccgctt cctcgctcac
     1441 tgactcgctg cgctcggtct gtcggctgcg gcgagcggta tcagctcact caaaggcggt
     1501 aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca
     1561 gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc
     1621 ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact
     1681 ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct
     1741 gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcaatg
     1801 ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca
     1861 cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa
     1921 cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc
     1981 gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag
     2041 aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg
     2101 tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca
     2161 gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc
     2221 tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag
     2281 gatcttcacc tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata
     2341 tgagtaaact tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat
     2401 ctgtctattt cgttcatcca tagctgcctg actccccgtc gtgtagataa ctacgatacg
     2461 ggagggctta ccatctggcc ccagtgctgc aatgataccg cgagacccac gctcaccggc
     2521 tccagattta tcagcaataa accagccagc cggaagggcc gagcgcagaa gtggtcctgc
     2581 aactttatcc gcctccatcc agtctattaa ttgttgccgg gaagctagag taagtagttc
     2641 gccagttaat agtttgcgca acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc
     2701 gtcgtttggt atggcttcat tcagctccgg ttcccaacga tcaaggcgag ttacatgatc
     2761 ccccatgttg tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg tcagaagtaa
     2821 gttggccgca gtgttatcac tcatggttat ggcagcactg cataattctc ttactgtcat
     2881 gccatccgta agatgctttt ctgtgactgg tgagtactca accaagtcat tctgagaata
     2941 gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaata cgggataata ccgcgccaca
     3001 tagcagaact ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa aactctcaag
     3061 gatcttaccg ctgttgagat ccagttcgat gtaacccact cgtgcaccca actgatcttc
     3121 agcatctttt actttcacca gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc
     3181 aaaaaaggga ataagggcga cacggaaatg ttgaatactc atactcttcc tttttcaata
     3241 ttattgaagc atttatcagg gttattgtct catgagcgga tacatatttg aatgtattta
     3301 gaaaaataaa caaatagggg ttccgcgcac atttccccga aaagtgccac ctgacgtcta
     3361 agaaaccatt attatcatga cattaaccta taaaaatagg cgtatcacga ggccctttcg
     3421 tcttcac

Product is for research use only!


Search name

pQE-12,Plasmid pQE-12,pQE-12 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
