pQE- 16 Plasmid


  • Model: PVT0514
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pQE-16,Plasmid pQE-16,pQE-16 vector


pQE-16 Information


Replicon: Ori

Terminator: Lambda t0

Plasmid Classification: E. coli Vector; pQE Series Expression Plasmid

Plasmid size: 3996bp

Plasmid label: N-DHFR, N-His

Prokaryotic resistance: ampicillin Amp

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic, LB

Expression host: M15

Culture conditions: 37 C, aerobic, LB

Induction: No Induction

5'Sequencing Primer: pQE30-F: AGCGGATAACAATTTCACAG

3'Sequencing primers: pQE30-R: TTCTGAGTCATTACTGGATC

Remarks: pQE vectors and constructs can be maintained in any E. coli strain that is ampicillin-sensitive and carries the pREP4 repressor plasmid, or harbors the lacIq gene on the F-factor episome.


pQE-16 Description



pQE-16 Sequence

LOCUS       Exported                3996 bp ds-DNA     circular SYN 08-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 6
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3996)
  TITLE     Direct Submission
  JOURNAL   Exported Thursday, September 8, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..3996
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        10..54
                     /note="T5 promoter"
                     /note="bacteriophage T5 promoter for E. coli RNA
                     polymerase, with embedded lac operator"
     protein_bind    30..46
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    62..78
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     RBS             97..108
                     /note="strong bacterial ribosome binding site (Elowitz and
                     Leibler, 2000)"
     CDS             133..690
                     /gene="Mus musculus Dhfr"
                     /product="mouse dihydrofolate reductase"
     CDS             703..720
                     /product="6xHis affinity tag"
     terminator      743..837
                     /note="lambda t0 terminator"
                     /note="transcription terminator from phage lambda"
     CDS             881..1540
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     terminator      1605..1691
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     misc_feature    1846..1986
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(2172..2760)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(2931..3791)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(3792..3896)
                     /note="AmpR promoter"
        1 ctcgagaaat cataaaaaat ttatttgctt tgtgagcgga taacaattat aatagattca
       61 attgtgagcg gataacaatt tcacacagaa ttcattaaag aggagaaatt aactatgaga
      121 ggatccggca tcatggttcg accattgaac tcgatcgtcg ccgtgtccca aaatatgggg
      181 attggcaaga acggagacct accctggcct ccgctcagga acgagttcaa gtacttccaa
      241 agaatgacca caacctcttc agtggaaggt aaacagaatc tggtgattat gggtaggaaa
      301 acctggttct ccattcctga gaagaatcga cctttaaagg acagaattaa tatagttctc
      361 agtagagaac tcaaagaacc accacgagga gctcattttc ttgccaaaag tttggatgat
      421 gccttaagac ttattgaaca accggaattg gcaagtaaag tagacatggt ttggatagtc
      481 ggaggcagtt ctgtttacca ggaagccatg aatcaaccag gccaccttag actctttgtg
      541 acaaggatca tgcaggaatt tgaaagtgac acgtttttcc cagaaattga tttggggaaa
      601 tataaacttc tcccagaata cccaggcgtc ctctctgagg tccaggagga aaaaggcatc
      661 aagtataagt ttgaagtcta cgagaagaaa ggttccagat ctcatcacca tcaccatcac
      721 taagcttaat tagctgagct tggactcctg ttgatagatc cagtaatgac ctcagaactc
      781 catctggatt tgttcagaac gctcggttgc cgccgggcgt tttttattgg tgagaatcca
      841 agctagcttg gcgagatttt caggagctaa ggaagctaaa atggagaaaa aaatcactgg
      901 atataccacc gttgatatat cccaatggca tcgtaaagaa cattttgagg catttcagtc
      961 agttgctcaa tgtacctata accagaccgt tcagctggat attacggcct ttttaaagac
     1021 cgtaaagaaa aataagcaca agttttatcc ggcctttatt cacattcttg cccgcctgat
     1081 gaatgctcat ccggaatttc gtatggcaat gaaagacggt gagctggtga tatgggatag
     1141 tgttcaccct tgttacaccg ttttccatga gcaaactgaa acgttttcat cgctctggag
     1201 tgaataccac gacgatttcc ggcagtttct acacatatat tcgcaagatg tggcgtgtta
     1261 cggtgaaaac ctggcctatt tccctaaagg gtttattgag aatatgtttt tcgtctcagc
     1321 caatccctgg gtgagtttca ccagttttga tttaaacgtg gccaatatgg acaacttctt
     1381 cgcccccgtt ttcaccatgg gcaaatatta tacgcaaggc gacaaggtgc tgatgccgct
     1441 ggcgattcag gttcatcatg ccgtttgtga tggcttccat gtcggcagaa tgcttaatga
     1501 attacaacag tactgcgatg agtggcaggg cggggcgtaa tttttttaag gcagttattg
     1561 gtgcccttaa acgcctgggg taatgactct ctagcttgag gcatcaaata aaacgaaagg
     1621 ctcagtcgaa agactgggcc tttcgtttta tctgttgttt gtcggtgaac gctctcctga
     1681 gtaggacaaa tccgccctct agagctgcct cgcgcgtttc ggtgatgacg gtgaaaacct
     1741 ctgacacatg cagctcccgg agacggtcac agcttgtctg taagcggatg ccgggagcag
     1801 acaagcccgt cagggcgcgt cagcgggtgt tggcgggtgt cggggcgcag ccatgaccca
     1861 gtcacgtagc gatagcggag tgtatactgg cttaactatg cggcatcaga gcagattgta
     1921 ctgagagtgc accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc
     1981 atcaggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg
     2041 cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac
     2101 gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg
     2161 ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca
     2221 agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc
     2281 tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc
     2341 ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag
     2401 gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc
     2461 ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca
     2521 gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg
     2581 aagtggtggc ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg
     2641 aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct
     2701 ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa
     2761 gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa
     2821 gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa
     2881 tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc
     2941 ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga
     3001 ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca
     3061 atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc
     3121 ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat
     3181 tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc
     3241 attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt
     3301 tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc
     3361 ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg
     3421 gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt
     3481 gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg
     3541 gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga
     3601 aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg
     3661 taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg
     3721 tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt
     3781 tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc
     3841 atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca
     3901 tttccccgaa aagtgccacc tgacgtctaa gaaaccatta ttatcatgac attaacctat
     3961 aaaaataggc gtatcacgag gccctttcgt cttcac


No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
